Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-200c-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
CTB-47B8.1
hsa-miR-200c-5p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000460082
Biotype: processed_pseudogene
Gene id: ENSG00000244331
Gene Name: CTB-47B8.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-200c-5p
Sequence: cgucuuacccagcaguguuugg
MirBase ID: MIMAT0004657
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:157931404-157931432
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2298J14.2
hsa-miR-200c-5p
IP

Gene Details
Chromosome: 14
Transcript: ENST00000557067
Biotype: lincRNA
Gene id: ENSG00000258636
Gene Name: CTD-2298J14.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
HREpiC Kidney Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-200c-5p
Sequence: cgucuuacccagcaguguuugg
MirBase ID: MIMAT0004657
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:41588054-41588082
exon
HITS-CLIP
DIRECT
LncBasev2
FAM211A-AS1
hsa-miR-200c-5p
IP

Gene Details
Chromosome: 17
Transcript: NR_027160.1
Biotype: antisense
Gene id: NR_027160.1 (gene)
Gene Name: FAM211A-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-200c-5p
Sequence: cgucuuacccagcaguguuugg
MirBase ID: MIMAT0004657
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:16439662-16439690
exon
HITS-CLIP
DIRECT
LncBasev2
FAM211A-AS1
hsa-miR-200c-5p
IP

Gene Details
Chromosome: 17
Transcript: NR_045026.1
Biotype: lincRNA
Gene id: NR_045026.1 (gene)
Gene Name: FAM211A-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-200c-5p
Sequence: cgucuuacccagcaguguuugg
MirBase ID: MIMAT0004657
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:16439662-16439690
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00657
hsa-miR-200c-5p
IP

Gene Details
Chromosome: 20
Transcript: ENST00000565493
Biotype: lincRNA
Gene id: ENSG00000260032
Gene Name: LINC00657
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-200c-5p
Sequence: cgucuuacccagcaguguuugg
MirBase ID: MIMAT0004657
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
20:36049985-36050013
exon
HITS-CLIP
DIRECT
LncBasev2
LRRC75A-AS1
hsa-miR-200c-5p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000497774
Biotype: retained_intron
Gene id: ENSG00000175061
Gene Name: LRRC75A-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-200c-5p
Sequence: cgucuuacccagcaguguuugg
MirBase ID: MIMAT0004657
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:16439662-16439690
exon
HITS-CLIP
DIRECT
LncBasev2
MALAT1
hsa-miR-200c-5p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000534336
Biotype: lincRNA
Gene id: ENSG00000251562
Gene Name: MALAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-200c-5p
Sequence: cgucuuacccagcaguguuugg
MirBase ID: MIMAT0004657
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65505916-65505944
exon
HITS-CLIP
DIRECT
LncBasev2
NAP1L1P1
hsa-miR-200c-5p
-
IP

Gene Details
Chromosome: 11
Transcript: ENST00000524793
Biotype: processed_pseudogene
Gene id: ENSG00000254759
Gene Name: NAP1L1P1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-200c-5p
Sequence: cgucuuacccagcaguguuugg
MirBase ID: MIMAT0004657
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:126067717-126067745
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-200c-5p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000501122
Biotype: lincRNA
Gene id: ENSG00000245532
Gene Name: NEAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-200c-5p
Sequence: cgucuuacccagcaguguuugg
MirBase ID: MIMAT0004657
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65434858-65434886
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65440425-65440453
exon
HITS-CLIP
DIRECT
LncBasev2
PABPC1P4
hsa-miR-200c-5p
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000539977
Biotype: processed_pseudogene
Gene id: ENSG00000255642
Gene Name: PABPC1P4
UCSC graphic:
Expression:
  Cell Line Tissue Category
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-200c-5p
Sequence: cgucuuacccagcaguguuugg
MirBase ID: MIMAT0004657
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:63823280-63823308
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:63823280-63823308
exon
HITS-CLIP
DIRECT
LncBasev2
PFN1P1
hsa-miR-200c-5p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000442087
Biotype: processed_pseudogene
Gene id: ENSG00000233328
Gene Name: PFN1P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-200c-5p
Sequence: cgucuuacccagcaguguuugg
MirBase ID: MIMAT0004657
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
HS27a
IP
Tested Cell Line: HS27a
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:171670611-171670639
exon
HITS-CLIP
DIRECT
LncBasev2
1:171670611-171670639
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-1033A18.1
hsa-miR-200c-5p
-
IP

Gene Details
Chromosome: 11
Transcript: ENST00000530115
Biotype: processed_pseudogene
Gene id: ENSG00000224411
Gene Name: RP11-1033A18.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-200c-5p
Sequence: cgucuuacccagcaguguuugg
MirBase ID: MIMAT0004657
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:27889543-27889571
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-365O16.1
hsa-miR-200c-5p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000415453
Biotype: processed_pseudogene
Gene id: ENSG00000236773
Gene Name: RP11-365O16.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-200c-5p
Sequence: cgucuuacccagcaguguuugg
MirBase ID: MIMAT0004657
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:224175548-224175576
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-405A12.1
hsa-miR-200c-5p
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000414406
Biotype: processed_pseudogene
Gene id: ENSG00000256849
Gene Name: RP11-405A12.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-200c-5p
Sequence: cgucuuacccagcaguguuugg
MirBase ID: MIMAT0004657
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:19941804-19941832
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-562A8.1
hsa-miR-200c-5p
-
IP

Gene Details
Chromosome: 15
Transcript: ENST00000495139
Biotype: processed_pseudogene
Gene id: ENSG00000242737
Gene Name: RP11-562A8.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-200c-5p
Sequence: cgucuuacccagcaguguuugg
MirBase ID: MIMAT0004657
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:50466939-50466967
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-680E19.1
hsa-miR-200c-5p
-
IP

Gene Details
Chromosome: 11
Transcript: ENST00000526101
Biotype: processed_transcript
Gene id: ENSG00000254811
Gene Name: RP11-680E19.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-200c-5p
Sequence: cgucuuacccagcaguguuugg
MirBase ID: MIMAT0004657
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:106254783-106254811
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-90L1.8
hsa-miR-200c-5p
IP

Gene Details
Chromosome: 13
Transcript: ENST00000611744
Biotype: antisense
Gene id: ENSG00000275880
Gene Name: RP11-90L1.8
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-200c-5p
Sequence: cgucuuacccagcaguguuugg
MirBase ID: MIMAT0004657
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
13:110614731-110614759
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-96D1.10
hsa-miR-200c-5p
IP

Gene Details
Chromosome: 16
Transcript: ENST00000571975
Biotype: sense_overlapping
Gene id: ENSG00000263276
Gene Name: RP11-96D1.10
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-200c-5p
Sequence: cgucuuacccagcaguguuugg
MirBase ID: MIMAT0004657
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
16:68226984-68227012
exon
HITS-CLIP
DIRECT
LncBasev2
RP4-798P15.3
hsa-miR-200c-5p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000466953
Biotype: retained_intron
Gene id: ENSG00000254154
Gene Name: RP4-798P15.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-200c-5p
Sequence: cgucuuacccagcaguguuugg
MirBase ID: MIMAT0004657
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:177940668-177940696
exon
HITS-CLIP
DIRECT
LncBasev2
RPL37P6
hsa-miR-200c-5p
-
IP

Gene Details
Chromosome: 8
Transcript: ENST00000464216
Biotype: processed_transcript
Gene id: ENSG00000241431
Gene Name: RPL37P6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-200c-5p
Sequence: cgucuuacccagcaguguuugg
MirBase ID: MIMAT0004657
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:56588545-56588573
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: