Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-21-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC012309.5
hsa-miR-21-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000592712
Biotype: lincRNA
Gene id: ENSG00000226686
Gene Name: AC012309.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-21-3p
Sequence: caacaccagucgaugggcugu
MirBase ID: MIMAT0004494
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:37263211-37263239
exon
HITS-CLIP
DIRECT
LncBasev2
AC078899.1
hsa-miR-21-3p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000521432
Biotype: processed_pseudogene
Gene id: ENSG00000213985
Gene Name: AC078899.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-21-3p
Sequence: caacaccagucgaugggcugu
MirBase ID: MIMAT0004494
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:20259040-20259068
exon
HITS-CLIP
DIRECT
LncBasev2
AP000347.2
hsa-miR-21-3p
-
IP

Gene Details
Chromosome: 22
Transcript: ENST00000417194
Biotype: processed_transcript
Gene id: ENSG00000272578
Gene Name: AP000347.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-21-3p
Sequence: caacaccagucgaugggcugu
MirBase ID: MIMAT0004494
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
22:23692816-23692850
exon
HITS-CLIP
DIRECT
LncBasev2
AP000436.4
hsa-miR-21-3p
-
IP

Gene Details
Chromosome: 11
Transcript: ENST00000605239
Biotype: processed_pseudogene
Gene id: ENSG00000270775
Gene Name: AP000436.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-21-3p
Sequence: caacaccagucgaugggcugu
MirBase ID: MIMAT0004494
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
11:65026224-65026252
exon
HITS-CLIP
DIRECT
LncBasev2
AP001505.10
hsa-miR-21-3p
-
IP

Gene Details
Chromosome: 21
Transcript: ENST00000616815
Biotype: lincRNA
Gene id: ENSG00000276529
Gene Name: AP001505.10
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-21-3p
Sequence: caacaccagucgaugggcugu
MirBase ID: MIMAT0004494
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
21:44979243-44979271
exon
HITS-CLIP
DIRECT
LncBasev2
ATP6V0E2-AS1
hsa-miR-21-3p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000461019
Biotype: antisense
Gene id: ENSG00000204934
Gene Name: ATP6V0E2-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-21-3p
Sequence: caacaccagucgaugggcugu
MirBase ID: MIMAT0004494
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:149869025-149869053
exon
HITS-CLIP
DIRECT
LncBasev2
BZW1P2
hsa-miR-21-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000473537
Biotype: processed_pseudogene
Gene id: ENSG00000198406
Gene Name: BZW1P2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-21-3p
Sequence: caacaccagucgaugggcugu
MirBase ID: MIMAT0004494
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:116646478-116646506
exon
HITS-CLIP
DIRECT
LncBasev2
CAHM
hsa-miR-21-3p
IP

Gene Details
Chromosome: 6
Transcript: ENST00000604200
Biotype: lincRNA
Gene id: ENSG00000270419
Gene Name: CAHM
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HepG2 Liver Cancer/Malignant

miRNA Details
Name: hsa-miR-21-3p
Sequence: caacaccagucgaugggcugu
MirBase ID: MIMAT0004494
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
6:163413622-163413650
exon
HITS-CLIP
DIRECT
LncBasev2
CAHM
hsa-miR-21-3p
IP

Gene Details
Chromosome: 6
Transcript: NR_037593.1
Biotype: lincRNA
Gene id: NR_037593.1 (gene)
Gene Name: CAHM
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HepG2 Liver Cancer/Malignant

miRNA Details
Name: hsa-miR-21-3p
Sequence: caacaccagucgaugggcugu
MirBase ID: MIMAT0004494
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
6:163413622-163413650
exon
HITS-CLIP
DIRECT
LncBasev2
CASC7
hsa-miR-21-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-21-3p
Sequence: caacaccagucgaugggcugu
MirBase ID: MIMAT0004494
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140524697-140524725
exon
HITS-CLIP
DIRECT
LncBasev2
CCT6P2
hsa-miR-21-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000507234
Biotype: processed_pseudogene
Gene id: ENSG00000250526
Gene Name: CCT6P2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-21-3p
Sequence: caacaccagucgaugggcugu
MirBase ID: MIMAT0004494
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
5:14639647-14639675
exon
HITS-CLIP
DIRECT
LncBasev2
CD24P4
hsa-miR-21-3p
-
IP

Gene Details
Chromosome: Y
Transcript: ENST00000382840
Biotype: processed_pseudogene
Gene id: ENSG00000185275
Gene Name: CD24P4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-21-3p
Sequence: caacaccagucgaugggcugu
MirBase ID: MIMAT0004494
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
Y:18992529-18992557
exon
HITS-CLIP
DIRECT
LncBasev2
CHKB-AS1
hsa-miR-21-3p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000380711
Biotype: antisense
Gene id: ENSG00000205559
Gene Name: CHKB-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary

miRNA Details
Name: hsa-miR-21-3p
Sequence: caacaccagucgaugggcugu
MirBase ID: MIMAT0004494
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
22:50583031-50583059
exon
HITS-CLIP
DIRECT
LncBasev2
chr22-38_28785274-29006793.1
hsa-miR-21-3p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-21-3p
Sequence: caacaccagucgaugggcugu
MirBase ID: MIMAT0004494
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
22:29146131-29146159
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-89H12.4
hsa-miR-21-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000499521
Biotype: retained_intron
Gene id: ENSG00000230551
Gene Name: CTB-89H12.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-21-3p
Sequence: caacaccagucgaugggcugu
MirBase ID: MIMAT0004494
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149494745-149494773
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2015B23.2
hsa-miR-21-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000514047
Biotype: processed_pseudogene
Gene id: ENSG00000226432
Gene Name: CTD-2015B23.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-21-3p
Sequence: caacaccagucgaugggcugu
MirBase ID: MIMAT0004494
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:24170768-24170796
exon
HITS-CLIP
DIRECT
LncBasev2
CYP2D8P
hsa-miR-21-3p
-
IP

Gene Details
Chromosome: 22
Transcript: ENST00000433633
Biotype: unprocessed_pseudogene
Gene id: ENSG00000226450
Gene Name: CYP2D8P
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-21-3p
Sequence: caacaccagucgaugggcugu
MirBase ID: MIMAT0004494
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
22:42152492-42152520
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P11
hsa-miR-21-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000415278
Biotype: processed_pseudogene
Gene id: ENSG00000228502
Gene Name: EEF1A1P11
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-21-3p
Sequence: caacaccagucgaugggcugu
MirBase ID: MIMAT0004494
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:96448096-96448124
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P12
hsa-miR-21-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000443590
Biotype: processed_pseudogene
Gene id: ENSG00000214199
Gene Name: EEF1A1P12
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-21-3p
Sequence: caacaccagucgaugggcugu
MirBase ID: MIMAT0004494
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:106698316-106698344
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P13
hsa-miR-21-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000503537
Biotype: processed_pseudogene
Gene id: ENSG00000250182
Gene Name: EEF1A1P13
UCSC graphic:
Expression:
  Cell Line Tissue Category
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-21-3p
Sequence: caacaccagucgaugggcugu
MirBase ID: MIMAT0004494
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:14652966-14652994
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: