Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-23c

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC090602.2
hsa-miR-23c
-
IP

Gene Details
Chromosome: 15
Transcript: ENST00000469695
Biotype: processed_pseudogene
Gene id: ENSG00000242088
Gene Name: AC090602.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-23c
Sequence: aucacauugccagugauuaccc
MirBase ID: MIMAT0018000
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:24911019-24911047
exon
HITS-CLIP
DIRECT
LncBasev2
AF127936.7
hsa-miR-23c
IP

Gene Details
Chromosome: 21
Transcript: ENST00000432230
Biotype: lincRNA
Gene id: ENSG00000235609
Gene Name: AF127936.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-23c
Sequence: aucacauugccagugauuaccc
MirBase ID: MIMAT0018000
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
21:14821382-14821410
exon
HITS-CLIP
DIRECT
LncBasev2
ANP32AP1
hsa-miR-23c
-
IP

Gene Details
Chromosome: 15
Transcript: ENST00000560832
Biotype: processed_transcript
Gene id: ENSG00000259516
Gene Name: ANP32AP1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-23c
Sequence: aucacauugccagugauuaccc
MirBase ID: MIMAT0018000
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HMSC
Category: Stem/Progenitor
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:35237356-35237384
exon
HITS-CLIP
DIRECT
LncBasev2
CASC7
hsa-miR-23c
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-23c
Sequence: aucacauugccagugauuaccc
MirBase ID: MIMAT0018000
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140528164-140528192
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-529I10.1
hsa-miR-23c
IP

Gene Details
Chromosome: 17
Transcript: ENST00000616896
Biotype: antisense
Gene id: ENSG00000275413
Gene Name: CTC-529I10.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-23c
Sequence: aucacauugccagugauuaccc
MirBase ID: MIMAT0018000
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:16023414-16023442
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2262B20.1
hsa-miR-23c
-
IP

Gene Details
Chromosome: 15
Transcript: ENST00000559487
Biotype: transcribed_processed_pseudogene
Gene id: ENSG00000259630
Gene Name: CTD-2262B20.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-23c
Sequence: aucacauugccagugauuaccc
MirBase ID: MIMAT0018000
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:85415342-85415370
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2542C24.2
hsa-miR-23c
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000595195
Biotype: unprocessed_pseudogene
Gene id: ENSG00000269779
Gene Name: CTD-2542C24.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-23c
Sequence: aucacauugccagugauuaccc
MirBase ID: MIMAT0018000
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:20696169-20696197
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2666L21.3
hsa-miR-23c
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000461223
Biotype: processed_pseudogene
Gene id: ENSG00000213293
Gene Name: CTD-2666L21.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-23c
Sequence: aucacauugccagugauuaccc
MirBase ID: MIMAT0018000
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:12260469-12260497
exon
HITS-CLIP
DIRECT
LncBasev2
DARS-AS1
hsa-miR-23c
IP

Gene Details
Chromosome: 2
Transcript: ENST00000597450
Biotype: antisense
Gene id: ENSG00000231890
Gene Name: DARS-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-23c
Sequence: aucacauugccagugauuaccc
MirBase ID: MIMAT0018000
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:135999879-135999907
exon
HITS-CLIP
DIRECT
LncBasev2
DGKZP1
hsa-miR-23c
-
IP

Gene Details
Chromosome: 13
Transcript: ENST00000378718
Biotype: processed_pseudogene
Gene id: ENSG00000179611
Gene Name: DGKZP1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-23c
Sequence: aucacauugccagugauuaccc
MirBase ID: MIMAT0018000
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
13:43969925-43969953
exon
HITS-CLIP
DIRECT
LncBasev2
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
13:43969925-43969953
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1B2P3
hsa-miR-23c
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000447718
Biotype: processed_pseudogene
Gene id: ENSG00000232472
Gene Name: EEF1B2P3
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-23c
Sequence: aucacauugccagugauuaccc
MirBase ID: MIMAT0018000
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:24788630-24788658
exon
HITS-CLIP
DIRECT
LncBasev2
FAM24B-CUZD1
hsa-miR-23c
IP

Gene Details
Chromosome: 10
Transcript: NR_037915.1
Biotype: sense
Gene id: NR_037915.1 (gene)
Gene Name: FAM24B-CUZD1
UCSC graphic: -
Expression: -

miRNA Details
Name: hsa-miR-23c
Sequence: aucacauugccagugauuaccc
MirBase ID: MIMAT0018000
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
10:122833811-122833839
exon
HITS-CLIP
DIRECT
LncBasev2
FTH1P11
hsa-miR-23c
-
IP

Gene Details
Chromosome: 8
Transcript: ENST00000517577
Biotype: processed_pseudogene
Gene id: ENSG00000237264
Gene Name: FTH1P11
UCSC graphic:
Expression:
  Cell Line Tissue Category
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-23c
Sequence: aucacauugccagugauuaccc
MirBase ID: MIMAT0018000
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:81521956-81521984
exon
HITS-CLIP
DIRECT
LncBasev2
8:81521897-81521925
exon
HITS-CLIP
DIRECT
LncBasev2
FTH1P15
hsa-miR-23c
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000406984
Biotype: processed_pseudogene
Gene id: ENSG00000218980
Gene Name: FTH1P15
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-23c
Sequence: aucacauugccagugauuaccc
MirBase ID: MIMAT0018000
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:57004654-57004682
exon
HITS-CLIP
DIRECT
LncBasev2
FTH1P2
hsa-miR-23c
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000466086
Biotype: processed_pseudogene
Gene id: ENSG00000234975
Gene Name: FTH1P2
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-23c
Sequence: aucacauugccagugauuaccc
MirBase ID: MIMAT0018000
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:228687523-228687551
exon
HITS-CLIP
DIRECT
LncBasev2
FTH1P20
hsa-miR-23c
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000434913
Biotype: processed_pseudogene
Gene id: ENSG00000226564
Gene Name: FTH1P20
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-23c
Sequence: aucacauugccagugauuaccc
MirBase ID: MIMAT0018000
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:180873139-180873167
exon
HITS-CLIP
DIRECT
LncBasev2
2:180873080-180873108
exon
HITS-CLIP
DIRECT
LncBasev2
GABPB1-AS1
hsa-miR-23c
IP

Gene Details
Chromosome: 15
Transcript: ENST00000499624
Biotype: antisense
Gene id: ENSG00000244879
Gene Name: GABPB1-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-23c
Sequence: aucacauugccagugauuaccc
MirBase ID: MIMAT0018000
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:50370150-50370178
exon
HITS-CLIP
DIRECT
LncBasev2
GJA9-MYCBP
hsa-miR-23c
IP

Gene Details
Chromosome: 1
Transcript: NR_037633.1
Biotype: sense
Gene id: NR_037633.1 (gene)
Gene Name: GJA9-MYCBP
UCSC graphic: -
Expression: -

miRNA Details
Name: hsa-miR-23c
Sequence: aucacauugccagugauuaccc
MirBase ID: MIMAT0018000
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:38863531-38863559
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00662
hsa-miR-23c
IP

Gene Details
Chromosome: 19
Transcript: ENST00000561521
Biotype: lincRNA
Gene id: ENSG00000261824
Gene Name: LINC00662
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-23c
Sequence: aucacauugccagugauuaccc
MirBase ID: MIMAT0018000
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:27730585-27730613
exon
HITS-CLIP
DIRECT
LncBasev2
LOC100289495
hsa-miR-23c
IP

Gene Details
Chromosome: 6
Transcript: NR_040022.1
Biotype: lincRNA
Gene id: NR_040022.1 (gene)
Gene Name: LOC100289495
UCSC graphic: -
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-23c
Sequence: aucacauugccagugauuaccc
MirBase ID: MIMAT0018000
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:166351072-166351100
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: