Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link


Loading... Please wait, this might take a few seconds...

Pr. score

Gene Details
Chromosome: 19
Transcript: ENST00000501448
Biotype: antisense
Gene id: ENSG00000248015
Gene Name: AC005329.7
UCSC graphic:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HepG2 Liver Cancer/Malignant

miRNA Details
Name: hsa-miR-24-1-5p
Sequence: ugccuacugagcugauaucagu
MirBase ID: MIMAT0000079
Related Diseases:

Cell Type
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Validation Type

Gene Details
Chromosome: 5
Transcript: ENST00000450941
Biotype: processed_pseudogene
Gene id: ENSG00000226221
Gene Name: AC022431.1
UCSC graphic:
  Cell Line Tissue Category
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-24-1-5p
Sequence: ugccuacugagcugauaucagu
MirBase ID: MIMAT0000079
Related Diseases:

Cell Type
Beta cells
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Validation Type

Gene Details
Chromosome: 11
Transcript: ENST00000564619
Biotype: lincRNA
Gene id: ENSG00000260254
Gene Name: AP000997.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-24-1-5p
Sequence: ugccuacugagcugauaucagu
MirBase ID: MIMAT0000079
Related Diseases:

Cell Type
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Validation Type

Gene Details
Chromosome: 1
Transcript: ENST00000608023
Biotype: lincRNA
Gene id: ENSG00000203709
Gene Name: C1orf132
UCSC graphic:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-24-1-5p
Sequence: ugccuacugagcugauaucagu
MirBase ID: MIMAT0000079
Related Diseases:

Cell Type
Beta cells
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Validation Type

Gene Details
Chromosome: 9
Transcript: ENST00000414656
Biotype: antisense
Gene id: ENSG00000228544
Gene Name: CCDC183-AS1
UCSC graphic:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-miR-24-1-5p
Sequence: ugccuacugagcugauaucagu
MirBase ID: MIMAT0000079
Related Diseases:

Cell Type
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Validation Type

Gene Details
Chromosome: 22
Transcript: NR_027928.2
Biotype: sense
Gene id: NR_027928.2 (gene)
Gene Name: CHKB-CPT1B
UCSC graphic: -
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-24-1-5p
Sequence: ugccuacugagcugauaucagu
MirBase ID: MIMAT0000079
Related Diseases:

Cell Type
Beta cells
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Validation Type

Gene Details
Chromosome: 5
Transcript: ENST00000499521
Biotype: retained_intron
Gene id: ENSG00000230551
Gene Name: CTB-89H12.4
UCSC graphic:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-24-1-5p
Sequence: ugccuacugagcugauaucagu
MirBase ID: MIMAT0000079
Related Diseases:

Cell Type
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Validation Type
Beta cells
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Validation Type

Gene Details
Chromosome: 5
Transcript: ENST00000534918
Biotype: retained_intron
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-24-1-5p
Sequence: ugccuacugagcugauaucagu
MirBase ID: MIMAT0000079
Related Diseases:

Cell Type
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Validation Type

Gene Details
Chromosome: 7
Transcript: ENST00000523006
Biotype: processed_pseudogene
Gene id: ENSG00000254270
Gene Name: ERHP1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-24-1-5p
Sequence: ugccuacugagcugauaucagu
MirBase ID: MIMAT0000079
Related Diseases:

Cell Type
Beta cells
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Validation Type

Gene Details
Chromosome: 11
Transcript: ENST00000414790
Biotype: lincRNA
Gene id: ENSG00000130600
Gene Name: H19
UCSC graphic:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-24-1-5p
Sequence: ugccuacugagcugauaucagu
MirBase ID: MIMAT0000079
Related Diseases:

Cell Type
Beta cells
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Validation Type

Gene Details
Chromosome: 7
Transcript: NR_037940.1
Biotype: sense
Gene id: NR_037940.1 (gene)
Gene Name: HOXA10-HOXA9
UCSC graphic: -
Expression: -

miRNA Details
Name: hsa-miR-24-1-5p
Sequence: ugccuacugagcugauaucagu
MirBase ID: MIMAT0000079
Related Diseases:

Cell Type
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Validation Type

Gene Details
Chromosome: 7
Transcript: ENST00000517635
Biotype: antisense
Gene id: ENSG00000253552
Gene Name: HOXA-AS2
UCSC graphic:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-24-1-5p
Sequence: ugccuacugagcugauaucagu
MirBase ID: MIMAT0000079
Related Diseases:

Cell Type
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Validation Type

Gene Details
Chromosome: 11
Transcript: ENST00000597346
Biotype: antisense
Gene id: ENSG00000269821
Gene Name: KCNQ1OT1
UCSC graphic:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-24-1-5p
Sequence: ugccuacugagcugauaucagu
MirBase ID: MIMAT0000079
Related Diseases:

Cell Type
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Validation Type

Gene Details
Chromosome: 16
Transcript: ENST00000566922
Biotype: lincRNA
Gene id: ENSG00000260646
Gene Name: LA16c-385E7.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-24-1-5p
Sequence: ugccuacugagcugauaucagu
MirBase ID: MIMAT0000079
Related Diseases:

Cell Type
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Validation Type

Gene Details
Chromosome: X
Transcript: ENST00000602455
Biotype: lincRNA
Gene id: ENSG00000270012
Gene Name: LL0XNC01-7P3.1
UCSC graphic:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant

miRNA Details
Name: hsa-miR-24-1-5p
Sequence: ugccuacugagcugauaucagu
MirBase ID: MIMAT0000079
Related Diseases:

Cell Type
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Validation Type

Gene Details
Chromosome: 11
Transcript: ENST00000534336
Biotype: lincRNA
Gene id: ENSG00000251562
Gene Name: MALAT1
UCSC graphic:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-24-1-5p
Sequence: ugccuacugagcugauaucagu
MirBase ID: MIMAT0000079
Related Diseases:

Cell Type
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Validation Type
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Validation Type
Tested Cell Line: HMSC
Category: Stem/Progenitor
Experimental Condition: -
Validation Type

Gene Details
Chromosome: 14
Transcript: ENST00000398460
Biotype: lincRNA
Gene id: ENSG00000214548
Gene Name: MEG3
UCSC graphic:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-24-1-5p
Sequence: ugccuacugagcugauaucagu
MirBase ID: MIMAT0000079
Related Diseases:

Cell Type
Beta cells
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Validation Type

Gene Details
Chromosome: X
Transcript: ENST00000433043
Biotype: processed_pseudogene
Gene id: ENSG00000232282
Gene Name: MTND1P32
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-24-1-5p
Sequence: ugccuacugagcugauaucagu
MirBase ID: MIMAT0000079
Related Diseases:

Cell Type
Beta cells
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Validation Type

Gene Details
Chromosome: 5
Transcript: ENST00000498999
Biotype: processed_pseudogene
Gene id: ENSG00000247627
Gene Name: MTND4P12
UCSC graphic:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-24-1-5p
Sequence: ugccuacugagcugauaucagu
MirBase ID: MIMAT0000079
Related Diseases:

Cell Type
Beta cells
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Validation Type

Gene Details
Chromosome: 3
Transcript: ENST00000602845
Biotype: lincRNA
Gene id: ENSG00000270170
Gene Name: NCBP2-AS2
UCSC graphic:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-24-1-5p
Sequence: ugccuacugagcugauaucagu
MirBase ID: MIMAT0000079
Related Diseases:

Cell Type
Bone Marrow
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Validation Type
Funded by: