Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-3065-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC004967.7
hsa-miR-3065-3p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000453589
Biotype: unprocessed_pseudogene
Gene id: ENSG00000243554
Gene Name: AC004967.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HREpiC Kidney Normal/Primary

miRNA Details
Name: hsa-miR-3065-3p
Sequence: ucagcaccaggauauuguuggag
MirBase ID: MIMAT0015378
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:97969028-97969056
exon
HITS-CLIP
DIRECT
LncBasev2
AC005562.1
hsa-miR-3065-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000440026
Biotype: processed_transcript
Gene id: ENSG00000214719
Gene Name: AC005562.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-3065-3p
Sequence: ucagcaccaggauauuguuggag
MirBase ID: MIMAT0015378
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:30608476-30608504
exon
HITS-CLIP
DIRECT
LncBasev2
AC005789.11
hsa-miR-3065-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000588453
Biotype: lincRNA
Gene id: ENSG00000267473
Gene Name: AC005789.11
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-3065-3p
Sequence: ucagcaccaggauauuguuggag
MirBase ID: MIMAT0015378
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:38399115-38399143
exon
HITS-CLIP
DIRECT
LncBasev2
AC007036.5
hsa-miR-3065-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000511893
Biotype: sense_overlapping
Gene id: ENSG00000251660
Gene Name: AC007036.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-3065-3p
Sequence: ucagcaccaggauauuguuggag
MirBase ID: MIMAT0015378
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:30159014-30159042
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:30159014-30159042
exon
HITS-CLIP
DIRECT
LncBasev2
AC011737.2
hsa-miR-3065-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000431098
Biotype: processed_pseudogene
Gene id: ENSG00000204196
Gene Name: AC011737.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-3065-3p
Sequence: ucagcaccaggauauuguuggag
MirBase ID: MIMAT0015378
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:203191230-203191258
exon
HITS-CLIP
DIRECT
LncBasev2
AC013394.2
hsa-miR-3065-3p
-
IP

Gene Details
Chromosome: 15
Transcript: ENST00000557682
Biotype: lincRNA
Gene id: ENSG00000272888
Gene Name: AC013394.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-3065-3p
Sequence: ucagcaccaggauauuguuggag
MirBase ID: MIMAT0015378
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:92885530-92885558
exon
HITS-CLIP
DIRECT
LncBasev2
AC013470.8
hsa-miR-3065-3p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000453438
Biotype: processed_pseudogene
Gene id: ENSG00000224667
Gene Name: AC013470.8
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3065-3p
Sequence: ucagcaccaggauauuguuggag
MirBase ID: MIMAT0015378
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:12506930-12506958
exon
HITS-CLIP
DIRECT
LncBasev2
AC078899.1
hsa-miR-3065-3p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000521432
Biotype: processed_pseudogene
Gene id: ENSG00000213985
Gene Name: AC078899.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3065-3p
Sequence: ucagcaccaggauauuguuggag
MirBase ID: MIMAT0015378
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:20259041-20259072
exon
HITS-CLIP
DIRECT
LncBasev2
AC090602.2
hsa-miR-3065-3p
-
IP

Gene Details
Chromosome: 15
Transcript: ENST00000469695
Biotype: processed_pseudogene
Gene id: ENSG00000242088
Gene Name: AC090602.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3065-3p
Sequence: ucagcaccaggauauuguuggag
MirBase ID: MIMAT0015378
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:24911047-24911075
exon
HITS-CLIP
DIRECT
LncBasev2
AC156455.1
hsa-miR-3065-3p
IP

Gene Details
Chromosome: 12
Transcript: ENST00000538790
Biotype: lincRNA
Gene id: ENSG00000256546
Gene Name: AC156455.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-3065-3p
Sequence: ucagcaccaggauauuguuggag
MirBase ID: MIMAT0015378
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:122068408-122068436
exon
HITS-CLIP
DIRECT
LncBasev2
AL845472.1
hsa-miR-3065-3p
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000624675
Biotype: pseudogene
Gene id: ENSG00000279561
Gene Name: AL845472.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3065-3p
Sequence: ucagcaccaggauauuguuggag
MirBase ID: MIMAT0015378
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:41271177-41271205
exon
HITS-CLIP
DIRECT
LncBasev2
ANP32BP1
hsa-miR-3065-3p
-
IP

Gene Details
Chromosome: 15
Transcript: ENST00000564205
Biotype: processed_transcript
Gene id: ENSG00000259790
Gene Name: ANP32BP1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3065-3p
Sequence: ucagcaccaggauauuguuggag
MirBase ID: MIMAT0015378
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
15:75322476-75322504
exon
HITS-CLIP
DIRECT
LncBasev2
ANXA2P2
hsa-miR-3065-3p
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000435128
Biotype: processed_pseudogene
Gene id: ENSG00000231991
Gene Name: ANXA2P2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3065-3p
Sequence: ucagcaccaggauauuguuggag
MirBase ID: MIMAT0015378
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:33624352-33624380
exon
HITS-CLIP
DIRECT
LncBasev2
AP000347.2
hsa-miR-3065-3p
-
IP

Gene Details
Chromosome: 22
Transcript: ENST00000417194
Biotype: processed_transcript
Gene id: ENSG00000272578
Gene Name: AP000347.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-3065-3p
Sequence: ucagcaccaggauauuguuggag
MirBase ID: MIMAT0015378
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
22:23683858-23683886
exon
HITS-CLIP
DIRECT
LncBasev2
22:23692815-23692849
exon
HITS-CLIP
DIRECT
LncBasev2
ARIH2P1
hsa-miR-3065-3p
-
IP

Gene Details
Chromosome: 18
Transcript: ENST00000584680
Biotype: processed_pseudogene
Gene id: ENSG00000266296
Gene Name: ARIH2P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3065-3p
Sequence: ucagcaccaggauauuguuggag
MirBase ID: MIMAT0015378
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
18:28653165-28653193
exon
HITS-CLIP
DIRECT
LncBasev2
BLOC1S5-TXNDC5
hsa-miR-3065-3p
IP

Gene Details
Chromosome: 6
Transcript: NR_037616.1
Biotype: sense
Gene id: NR_037616.1 (gene)
Gene Name: BLOC1S5-TXNDC5
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-3065-3p
Sequence: ucagcaccaggauauuguuggag
MirBase ID: MIMAT0015378
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:7888728-7888756
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
6:7882209-7882237
exon
HITS-CLIP
DIRECT
LncBasev2
C1orf132
hsa-miR-3065-3p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000608023
Biotype: lincRNA
Gene id: ENSG00000203709
Gene Name: C1orf132
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-3065-3p
Sequence: ucagcaccaggauauuguuggag
MirBase ID: MIMAT0015378
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
1:207814378-207814406
exon
HITS-CLIP
DIRECT
LncBasev2
C1orf220
hsa-miR-3065-3p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000521244
Biotype: lincRNA
Gene id: ENSG00000213057
Gene Name: C1orf220
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant

miRNA Details
Name: hsa-miR-3065-3p
Sequence: ucagcaccaggauauuguuggag
MirBase ID: MIMAT0015378
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
1:178545564-178545592
exon
HITS-CLIP
DIRECT
LncBasev2
CASC7
hsa-miR-3065-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-3065-3p
Sequence: ucagcaccaggauauuguuggag
MirBase ID: MIMAT0015378
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
8:140520496-140520524
exon
HITS-CLIP
DIRECT
LncBasev2
CCT8P1
hsa-miR-3065-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000413611
Biotype: processed_pseudogene
Gene id: ENSG00000226015
Gene Name: CCT8P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3065-3p
Sequence: ucagcaccaggauauuguuggag
MirBase ID: MIMAT0015378
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:147203606-147203634
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: