Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-3065-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC006548.28
hsa-miR-3065-5p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623130
Biotype: sense_overlapping
Gene id: ENSG00000280156
Gene Name: AC006548.28
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3065-5p
Sequence: ucaacaaaaucacugaugcugga
MirBase ID: MIMAT0015066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
22:16993758-16993786
exon
HITS-CLIP
DIRECT
LncBasev2
AC011742.5
hsa-miR-3065-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000431448
Biotype: processed_pseudogene
Gene id: ENSG00000227133
Gene Name: AC011742.5
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3065-5p
Sequence: ucaacaaaaucacugaugcugga
MirBase ID: MIMAT0015066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
2:26160562-26160590
exon
HITS-CLIP
DIRECT
LncBasev2
AC012309.5
hsa-miR-3065-5p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000592712
Biotype: lincRNA
Gene id: ENSG00000226686
Gene Name: AC012309.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-3065-5p
Sequence: ucaacaaaaucacugaugcugga
MirBase ID: MIMAT0015066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:37263166-37263194
exon
HITS-CLIP
DIRECT
LncBasev2
AC016739.2
hsa-miR-3065-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000405359
Biotype: processed_pseudogene
Gene id: ENSG00000218175
Gene Name: AC016739.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-3065-5p
Sequence: ucaacaaaaucacugaugcugga
MirBase ID: MIMAT0015066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:176201134-176201162
exon
HITS-CLIP
DIRECT
LncBasev2
AC092155.1
hsa-miR-3065-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000454675
Biotype: processed_pseudogene
Gene id: ENSG00000229503
Gene Name: AC092155.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3065-5p
Sequence: ucaacaaaaucacugaugcugga
MirBase ID: MIMAT0015066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:62532834-62532862
exon
HITS-CLIP
DIRECT
LncBasev2
AL590762.11
hsa-miR-3065-5p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000391782
Biotype: processed_pseudogene
Gene id: ENSG00000213018
Gene Name: AL590762.11
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3065-5p
Sequence: ucaacaaaaucacugaugcugga
MirBase ID: MIMAT0015066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:71420462-71420490
exon
HITS-CLIP
DIRECT
LncBasev2
AL845472.1
hsa-miR-3065-5p
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000624675
Biotype: pseudogene
Gene id: ENSG00000279561
Gene Name: AL845472.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3065-5p
Sequence: ucaacaaaaucacugaugcugga
MirBase ID: MIMAT0015066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:41271177-41271205
exon
HITS-CLIP
DIRECT
LncBasev2
AP000347.2
hsa-miR-3065-5p
-
IP

Gene Details
Chromosome: 22
Transcript: ENST00000417194
Biotype: processed_transcript
Gene id: ENSG00000272578
Gene Name: AP000347.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-3065-5p
Sequence: ucaacaaaaucacugaugcugga
MirBase ID: MIMAT0015066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:23658757-23658785
exon
HITS-CLIP
DIRECT
LncBasev2
AP000436.4
hsa-miR-3065-5p
-
IP

Gene Details
Chromosome: 11
Transcript: ENST00000605239
Biotype: processed_pseudogene
Gene id: ENSG00000270775
Gene Name: AP000436.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3065-5p
Sequence: ucaacaaaaucacugaugcugga
MirBase ID: MIMAT0015066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
11:65026223-65026251
exon
HITS-CLIP
DIRECT
LncBasev2
AP000593.6
hsa-miR-3065-5p
-
IP

Gene Details
Chromosome: 11
Transcript: ENST00000393668
Biotype: processed_pseudogene
Gene id: ENSG00000213365
Gene Name: AP000593.6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3065-5p
Sequence: ucaacaaaaucacugaugcugga
MirBase ID: MIMAT0015066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
11:72280384-72280412
exon
HITS-CLIP
DIRECT
LncBasev2
BLOC1S5-TXNDC5
hsa-miR-3065-5p
IP

Gene Details
Chromosome: 6
Transcript: NR_037616.1
Biotype: sense
Gene id: NR_037616.1 (gene)
Gene Name: BLOC1S5-TXNDC5
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-3065-5p
Sequence: ucaacaaaaucacugaugcugga
MirBase ID: MIMAT0015066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
6:7882782-7882810
exon
HITS-CLIP
DIRECT
LncBasev2
BZW1P2
hsa-miR-3065-5p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000473537
Biotype: processed_pseudogene
Gene id: ENSG00000198406
Gene Name: BZW1P2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-3065-5p
Sequence: ucaacaaaaucacugaugcugga
MirBase ID: MIMAT0015066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:116646477-116646505
exon
HITS-CLIP
DIRECT
LncBasev2
C1orf132
hsa-miR-3065-5p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000608023
Biotype: lincRNA
Gene id: ENSG00000203709
Gene Name: C1orf132
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-3065-5p
Sequence: ucaacaaaaucacugaugcugga
MirBase ID: MIMAT0015066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
1:207811536-207811564
exon
HITS-CLIP
DIRECT
LncBasev2
CASC7
hsa-miR-3065-5p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-3065-5p
Sequence: ucaacaaaaucacugaugcugga
MirBase ID: MIMAT0015066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
8:140525159-140525187
exon
HITS-CLIP
DIRECT
LncBasev2
CDC42P6
hsa-miR-3065-5p
-
IP

Gene Details
Chromosome: 4
Transcript: ENST00000421246
Biotype: processed_pseudogene
Gene id: ENSG00000237350
Gene Name: CDC42P6
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-3065-5p
Sequence: ucaacaaaaucacugaugcugga
MirBase ID: MIMAT0015066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:22727610-22727638
exon
HITS-CLIP
DIRECT
LncBasev2
CTAGE10P
hsa-miR-3065-5p
-
IP

Gene Details
Chromosome: 13
Transcript: ENST00000318353
Biotype: processed_pseudogene
Gene id: ENSG00000181358
Gene Name: CTAGE10P
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3065-5p
Sequence: ucaacaaaaucacugaugcugga
MirBase ID: MIMAT0015066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
13:49890723-49890751
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-89H12.4
hsa-miR-3065-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000499521
Biotype: retained_intron
Gene id: ENSG00000230551
Gene Name: CTB-89H12.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-3065-5p
Sequence: ucaacaaaaucacugaugcugga
MirBase ID: MIMAT0015066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
5:149494391-149494419
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2015B23.2
hsa-miR-3065-5p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000514047
Biotype: processed_pseudogene
Gene id: ENSG00000226432
Gene Name: CTD-2015B23.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3065-5p
Sequence: ucaacaaaaucacugaugcugga
MirBase ID: MIMAT0015066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:24170986-24171014
exon
HITS-CLIP
DIRECT
LncBasev2
DYX1C1-CCPG1
hsa-miR-3065-5p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000565113
Biotype: processed_transcript
Gene id: ENSG00000261771
Gene Name: DYX1C1-CCPG1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3065-5p
Sequence: ucaacaaaaucacugaugcugga
MirBase ID: MIMAT0015066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:55360412-55360440
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P10
hsa-miR-3065-5p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000475365
Biotype: processed_pseudogene
Gene id: ENSG00000243746
Gene Name: EEF1A1P10
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-3065-5p
Sequence: ucaacaaaaucacugaugcugga
MirBase ID: MIMAT0015066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
7:144648225-144648253
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: