Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-31-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AP002954.3
hsa-miR-31-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000530198
Biotype: antisense
Gene id: ENSG00000255176
Gene Name: AP002954.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-31-3p
Sequence: ugcuaugccaacauauugccau
MirBase ID: MIMAT0004504
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
11:118638036-118638064
exon
HITS-CLIP
DIRECT
LncBasev2
chr22-38_28785274-29006793.1
hsa-miR-31-3p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-31-3p
Sequence: ugcuaugccaacauauugccau
MirBase ID: MIMAT0004504
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
22:28955553-28955581
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.7
hsa-miR-31-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000534918
Biotype: retained_intron
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-31-3p
Sequence: ugcuaugccaacauauugccau
MirBase ID: MIMAT0004504
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
5:478906-478934
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2666L21.3
hsa-miR-31-3p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000461223
Biotype: processed_pseudogene
Gene id: ENSG00000213293
Gene Name: CTD-2666L21.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-31-3p
Sequence: ugcuaugccaacauauugccau
MirBase ID: MIMAT0004504
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:12260422-12260450
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00639
hsa-miR-31-3p
IP

Gene Details
Chromosome: 14
Transcript: ENST00000553932
Biotype: lincRNA
Gene id: ENSG00000259070
Gene Name: LINC00639
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-31-3p
Sequence: ugcuaugccaacauauugccau
MirBase ID: MIMAT0004504
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
14:38837774-38837802
exon
HITS-CLIP
DIRECT
LncBasev2
14:38837774-38837802
exon
HITS-CLIP
DIRECT
LncBasev2
14:38837774-38837802
exon
HITS-CLIP
DIRECT
LncBasev2
14:38837774-38837802
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00639
hsa-miR-31-3p
IP

Gene Details
Chromosome: 14
Transcript: NR_039982.1
Biotype: lincRNA
Gene id: NR_039982.1 (gene)
Gene Name: LINC00639
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary

miRNA Details
Name: hsa-miR-31-3p
Sequence: ugcuaugccaacauauugccau
MirBase ID: MIMAT0004504
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
14:38837774-38837802
exon
HITS-CLIP
DIRECT
LncBasev2
14:38837774-38837802
exon
HITS-CLIP
DIRECT
LncBasev2
14:38837774-38837802
exon
HITS-CLIP
DIRECT
LncBasev2
14:38837774-38837802
exon
HITS-CLIP
DIRECT
LncBasev2
MALAT1
hsa-miR-31-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000534336
Biotype: lincRNA
Gene id: ENSG00000251562
Gene Name: MALAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-31-3p
Sequence: ugcuaugccaacauauugccau
MirBase ID: MIMAT0004504
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HMSC
Category: Stem/Progenitor
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65503489-65503517
exon
HITS-CLIP
DIRECT
LncBasev2
11:65503489-65503517
exon
HITS-CLIP
DIRECT
LncBasev2
11:65503489-65503517
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
11:65503489-65503517
exon
HITS-CLIP
DIRECT
LncBasev2
11:65503489-65503517
exon
HITS-CLIP
DIRECT
LncBasev2
11:65499953-65499981
exon
HITS-CLIP
DIRECT
LncBasev2
11:65503489-65503517
exon
HITS-CLIP
DIRECT
LncBasev2
11:65503489-65503517
exon
HITS-CLIP
DIRECT
LncBasev2
11:65503489-65503517
exon
HITS-CLIP
DIRECT
LncBasev2
11:65499953-65499981
exon
HITS-CLIP
DIRECT
LncBasev2
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
11:65503489-65503517
exon
HITS-CLIP
DIRECT
LncBasev2
MTND4P12
hsa-miR-31-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000498999
Biotype: processed_pseudogene
Gene id: ENSG00000247627
Gene Name: MTND4P12
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-31-3p
Sequence: ugcuaugccaacauauugccau
MirBase ID: MIMAT0004504
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRNA.
Location
Region
Method
Result
Validation Type
Source
5:134927152-134927180
exon
HITS-CLIP
DIRECT
LncBasev2
MTND5P11
hsa-miR-31-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000511037
Biotype: processed_pseudogene
Gene id: ENSG00000248923
Gene Name: MTND5P11
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-31-3p
Sequence: ugcuaugccaacauauugccau
MirBase ID: MIMAT0004504
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRNA.
Location
Region
Method
Result
Validation Type
Source
5:134925190-134925218
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-31-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000501122
Biotype: lincRNA
Gene id: ENSG00000245532
Gene Name: NEAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-31-3p
Sequence: ugcuaugccaacauauugccau
MirBase ID: MIMAT0004504
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:hippuristanol
Location
Region
Method
Result
Validation Type
Source
11:65423073-65423101
exon
HITS-CLIP
DIRECT
LncBasev2
11:65423073-65423101
exon
HITS-CLIP
DIRECT
LncBasev2
11:65441230-65441258
exon
HITS-CLIP
DIRECT
LncBasev2
11:65439479-65439507
exon
HITS-CLIP
DIRECT
LncBasev2
11:65436863-65436891
exon
HITS-CLIP
DIRECT
LncBasev2
11:65423073-65423101
exon
HITS-CLIP
DIRECT
LncBasev2
11:65435784-65435812
exon
HITS-CLIP
DIRECT
LncBasev2
11:65436863-65436891
exon
HITS-CLIP
DIRECT
LncBasev2
11:65428180-65428208
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65441230-65441258
exon
HITS-CLIP
DIRECT
LncBasev2
11:65428180-65428208
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-31-3p
IP

Gene Details
Chromosome: 11
Transcript: NR_028272.1
Biotype: lincRNA
Gene id: NR_028272.1 (gene)
Gene Name: NEAT1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-31-3p
Sequence: ugcuaugccaacauauugccau
MirBase ID: MIMAT0004504
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
11:65423073-65423101
exon
HITS-CLIP
DIRECT
LncBasev2
11:65423073-65423101
exon
HITS-CLIP
DIRECT
LncBasev2
11:65423073-65423101
exon
HITS-CLIP
DIRECT
LncBasev2
NNT-AS1
hsa-miR-31-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000513560
Biotype: antisense
Gene id: ENSG00000248092
Gene Name: NNT-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-31-3p
Sequence: ugcuaugccaacauauugccau
MirBase ID: MIMAT0004504
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
5:43575510-43575538
exon
HITS-CLIP
DIRECT
LncBasev2
NNT-AS1
hsa-miR-31-3p
-
IP

Gene Details
Chromosome: 5
Transcript: NR_073113.1
Biotype: antisense
Gene id: NR_073113.1 (gene)
Gene Name: NNT-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-31-3p
Sequence: ugcuaugccaacauauugccau
MirBase ID: MIMAT0004504
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
5:43575510-43575538
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-309L24.10
hsa-miR-31-3p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000613068
Biotype: lincRNA
Gene id: ENSG00000275106
Gene Name: RP11-309L24.10
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-31-3p
Sequence: ugcuaugccaacauauugccau
MirBase ID: MIMAT0004504
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
7:128952851-128952879
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-44N21.4
hsa-miR-31-3p
-
IP

Gene Details
Chromosome: 14
Transcript: ENST00000548203
Biotype: processed_transcript
Gene id: ENSG00000257622
Gene Name: RP11-44N21.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-31-3p
Sequence: ugcuaugccaacauauugccau
MirBase ID: MIMAT0004504
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
14:105152224-105152252
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-735A19.2
hsa-miR-31-3p
-
IP

Gene Details
Chromosome: 11
Transcript: ENST00000545950
Biotype: unprocessed_pseudogene
Gene id: ENSG00000255855
Gene Name: RP11-735A19.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-31-3p
Sequence: ugcuaugccaacauauugccau
MirBase ID: MIMAT0004504
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
11:95050482-95050510
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-744K17.1
hsa-miR-31-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000562182
Biotype: lincRNA
Gene id: ENSG00000261020
Gene Name: RP11-744K17.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-31-3p
Sequence: ugcuaugccaacauauugccau
MirBase ID: MIMAT0004504
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
17:22420190-22420218
exon
HITS-CLIP
DIRECT
LncBasev2
RP1-239B22.5
hsa-miR-31-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000568280
Biotype: antisense
Gene id: ENSG00000260196
Gene Name: RP1-239B22.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant

miRNA Details
Name: hsa-miR-31-3p
Sequence: ugcuaugccaacauauugccau
MirBase ID: MIMAT0004504
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
11:17380915-17380943
exon
HITS-CLIP
DIRECT
LncBasev2
RP1-95L4.2
hsa-miR-31-3p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000404020
Biotype: processed_pseudogene
Gene id: ENSG00000217495
Gene Name: RP1-95L4.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-31-3p
Sequence: ugcuaugccaacauauugccau
MirBase ID: MIMAT0004504
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
6:143298808-143298836
exon
HITS-CLIP
DIRECT
LncBasev2
RP5-857K21.7
hsa-miR-31-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000427426
Biotype: unprocessed_pseudogene
Gene id: ENSG00000229344
Gene Name: RP5-857K21.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-31-3p
Sequence: ugcuaugccaacauauugccau
MirBase ID: MIMAT0004504
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRNA.
Location
Region
Method
Result
Validation Type
Source
1:633412-633440
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: