Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-31-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
ABHD14A-ACY1
hsa-miR-31-5p
IP

Gene Details
Chromosome: 3
Transcript: NR_037192.1
Biotype: sense
Gene id: NR_037192.1 (gene)
Gene Name: ABHD14A-ACY1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-31-5p
Sequence: aggcaagaugcuggcauagcu
MirBase ID: MIMAT0000089
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:51989018-51989046
exon
HITS-CLIP
DIRECT
LncBasev2
AC000089.3
hsa-miR-31-5p
-
IP

Gene Details
Chromosome: 22
Transcript: ENST00000424559
Biotype: processed_pseudogene
Gene id: ENSG00000235776
Gene Name: AC000089.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-31-5p
Sequence: aggcaagaugcuggcauagcu
MirBase ID: MIMAT0000089
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
22:19792778-19792806
exon
HITS-CLIP
DIRECT
LncBasev2
AC009133.15
hsa-miR-31-5p
IP

Gene Details
Chromosome: 16
Transcript: ENST00000566537
Biotype: antisense
Gene id: ENSG00000259952
Gene Name: AC009133.15
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-31-5p
Sequence: aggcaagaugcuggcauagcu
MirBase ID: MIMAT0000089
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
16:29807637-29807665
exon
HITS-CLIP
DIRECT
LncBasev2
16:29807637-29807665
exon
HITS-CLIP
DIRECT
LncBasev2
AC012487.2
hsa-miR-31-5p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000440975
Biotype: antisense
Gene id: ENSG00000214184
Gene Name: AC012487.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant

miRNA Details
Name: hsa-miR-31-5p
Sequence: aggcaagaugcuggcauagcu
MirBase ID: MIMAT0000089
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
2:108534053-108534081
exon
HITS-CLIP
DIRECT
LncBasev2
AC074117.10
hsa-miR-31-5p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000447070
Biotype: antisense
Gene id: ENSG00000234072
Gene Name: AC074117.10
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-31-5p
Sequence: aggcaagaugcuggcauagcu
MirBase ID: MIMAT0000089
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
HS27a
IP
Tested Cell Line: HS27a
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:27357845-27357873
exon
HITS-CLIP
DIRECT
LncBasev2
2:27357845-27357873
exon
HITS-CLIP
DIRECT
LncBasev2
AC099535.4
hsa-miR-31-5p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000408928
Biotype: processed_pseudogene
Gene id: ENSG00000230807
Gene Name: AC099535.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-31-5p
Sequence: aggcaagaugcuggcauagcu
MirBase ID: MIMAT0000089
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
3:27486525-27486553
exon
HITS-CLIP
DIRECT
LncBasev2
AL845472.1
hsa-miR-31-5p
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000624675
Biotype: pseudogene
Gene id: ENSG00000279561
Gene Name: AL845472.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-31-5p
Sequence: aggcaagaugcuggcauagcu
MirBase ID: MIMAT0000089
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:41271573-41271601
exon
HITS-CLIP
DIRECT
LncBasev2
BCYRN1
hsa-miR-31-5p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000418539
Biotype: lincRNA
Gene id: ENSG00000236824
Gene Name: BCYRN1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-31-5p
Sequence: aggcaagaugcuggcauagcu
MirBase ID: MIMAT0000089
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
2:47335500-47335528
exon
HITS-CLIP
DIRECT
LncBasev2
2:47335500-47335528
exon
HITS-CLIP
DIRECT
LncBasev2
2:47335500-47335528
exon
HITS-CLIP
DIRECT
LncBasev2
2:47335500-47335528
exon
HITS-CLIP
DIRECT
LncBasev2
BCYRN1
hsa-miR-31-5p
-
IP

Gene Details
Chromosome: 2
Transcript: NR_001568.1
Biotype: lincRNA
Gene id: NR_001568.1 (gene)
Gene Name: BCYRN1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-31-5p
Sequence: aggcaagaugcuggcauagcu
MirBase ID: MIMAT0000089
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
2:47335500-47335528
exon
HITS-CLIP
DIRECT
LncBasev2
2:47335500-47335528
exon
HITS-CLIP
DIRECT
LncBasev2
2:47335500-47335528
exon
HITS-CLIP
DIRECT
LncBasev2
2:47335500-47335528
exon
HITS-CLIP
DIRECT
LncBasev2
C1orf132
hsa-miR-31-5p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000608023
Biotype: lincRNA
Gene id: ENSG00000203709
Gene Name: C1orf132
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-31-5p
Sequence: aggcaagaugcuggcauagcu
MirBase ID: MIMAT0000089
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
1:207807033-207807061
exon
HITS-CLIP
DIRECT
LncBasev2
CASC7
hsa-miR-31-5p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-31-5p
Sequence: aggcaagaugcuggcauagcu
MirBase ID: MIMAT0000089
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140526567-140526595
exon
HITS-CLIP
DIRECT
LncBasev2
CCAT1
hsa-miR-31-5p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000500112
Biotype: lincRNA
Gene id: ENSG00000247844
Gene Name: CCAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary

miRNA Details
Name: hsa-miR-31-5p
Sequence: aggcaagaugcuggcauagcu
MirBase ID: MIMAT0000089
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: TZMBL
Category: Cancer/Malignant
Experimental Condition: shRNs against HIV-1
Location
Region
Method
Result
Validation Type
Source
8:127209398-127209426
exon
HITS-CLIP
DIRECT
LncBasev2
CDC42P1
hsa-miR-31-5p
-
IP

Gene Details
Chromosome: 20
Transcript: ENST00000456658
Biotype: processed_pseudogene
Gene id: ENSG00000234933
Gene Name: CDC42P1
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-31-5p
Sequence: aggcaagaugcuggcauagcu
MirBase ID: MIMAT0000089
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
20:34402332-34402360
exon
HITS-CLIP
DIRECT
LncBasev2
CDC42P5
hsa-miR-31-5p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000518654
Biotype: processed_pseudogene
Gene id: ENSG00000253439
Gene Name: CDC42P5
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-31-5p
Sequence: aggcaagaugcuggcauagcu
MirBase ID: MIMAT0000089
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:173085836-173085864
exon
HITS-CLIP
DIRECT
LncBasev2
CEBPA-AS1
hsa-miR-31-5p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000592982
Biotype: antisense
Gene id: ENSG00000267296
Gene Name: CEBPA-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HepG2 Liver Cancer/Malignant

miRNA Details
Name: hsa-miR-31-5p
Sequence: aggcaagaugcuggcauagcu
MirBase ID: MIMAT0000089
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
19:33304445-33304473
exon
HITS-CLIP
DIRECT
LncBasev2
CTA-445C9.14
hsa-miR-31-5p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000566814
Biotype: antisense
Gene id: ENSG00000261188
Gene Name: CTA-445C9.14
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-31-5p
Sequence: aggcaagaugcuggcauagcu
MirBase ID: MIMAT0000089
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:26514353-26514381
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-50E14.5
hsa-miR-31-5p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000600255
Biotype: processed_pseudogene
Gene id: ENSG00000269374
Gene Name: CTB-50E14.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-31-5p
Sequence: aggcaagaugcuggcauagcu
MirBase ID: MIMAT0000089
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:42485427-42485455
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-451P13.1
hsa-miR-31-5p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000474167
Biotype: processed_pseudogene
Gene id: ENSG00000213757
Gene Name: CTC-451P13.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-31-5p
Sequence: aggcaagaugcuggcauagcu
MirBase ID: MIMAT0000089
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:79284318-79284346
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2122P11.1
hsa-miR-31-5p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000504215
Biotype: processed_pseudogene
Gene id: ENSG00000251478
Gene Name: CTD-2122P11.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-31-5p
Sequence: aggcaagaugcuggcauagcu
MirBase ID: MIMAT0000089
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
5:41587436-41587464
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.7
hsa-miR-31-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000534918
Biotype: retained_intron
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-31-5p
Sequence: aggcaagaugcuggcauagcu
MirBase ID: MIMAT0000089
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
5:478894-478922
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: