Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-3173-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
C5orf56
hsa-miR-3173-3p
IP

Gene Details
Chromosome: 5
Transcript: NR_045116.1
Biotype: sense
Gene id: NR_045116.1 (gene)
Gene Name: C5orf56
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-3173-3p
Sequence: aaaggaggaaauaggcaggcca
MirBase ID: MIMAT0015048
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCLBAC
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:132475973-132476001
exon
PAR-CLIP
DIRECT
LncBasev2
RP1-107N3.1
hsa-miR-3173-3p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000417272
Biotype: processed_pseudogene
Gene id: ENSG00000235274
Gene Name: RP1-107N3.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3173-3p
Sequence: aaaggaggaaauaggcaggcca
MirBase ID: MIMAT0015048
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCLBACD1
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:127728761-127728789
exon
PAR-CLIP
DIRECT
LncBasev2
RP1-281H8.3
hsa-miR-3173-3p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000406807
Biotype: processed_pseudogene
Gene id: ENSG00000219553
Gene Name: RP1-281H8.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3173-3p
Sequence: aaaggaggaaauaggcaggcca
MirBase ID: MIMAT0015048
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCLBACD1
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:149491819-149491847
exon
PAR-CLIP
DIRECT
LncBasev2
Funded by: