Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-33b-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC103564.6
hsa-miR-33b-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000432853
Biotype: unprocessed_pseudogene
Gene id: ENSG00000232760
Gene Name: AC103564.6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-33b-3p
Sequence: cagugccucggcagugcagccc
MirBase ID: MIMAT0004811
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:131836139-131836167
exon
HITS-CLIP
DIRECT
LncBasev2
AF127936.5
hsa-miR-33b-3p
IP

Gene Details
Chromosome: 21
Transcript: ENST00000435315
Biotype: lincRNA
Gene id: ENSG00000226751
Gene Name: AF127936.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Kidney Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- White Blood Cell Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-33b-3p
Sequence: cagugccucggcagugcagccc
MirBase ID: MIMAT0004811
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
21:14763016-14763044
exon
PAR-CLIP
DIRECT
LncBasev2
CASC7
hsa-miR-33b-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-33b-3p
Sequence: cagugccucggcagugcagccc
MirBase ID: MIMAT0004811
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: EF3DAGO2
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140527461-140527489
exon
PAR-CLIP
DIRECT
LncBasev2
CCAT1
hsa-miR-33b-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000500112
Biotype: lincRNA
Gene id: ENSG00000247844
Gene Name: CCAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary

miRNA Details
Name: hsa-miR-33b-3p
Sequence: cagugccucggcagugcagccc
MirBase ID: MIMAT0004811
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
8:127218841-127218869
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2015B23.2
hsa-miR-33b-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000514047
Biotype: processed_pseudogene
Gene id: ENSG00000226432
Gene Name: CTD-2015B23.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-33b-3p
Sequence: cagugccucggcagugcagccc
MirBase ID: MIMAT0004811
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:24171006-24171034
exon
HITS-CLIP
DIRECT
LncBasev2
EIF1P3
hsa-miR-33b-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000423841
Biotype: processed_pseudogene
Gene id: ENSG00000231684
Gene Name: EIF1P3
UCSC graphic:
Expression:
  Cell Line Tissue Category
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-33b-3p
Sequence: cagugccucggcagugcagccc
MirBase ID: MIMAT0004811
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:182336055-182336083
exon
HITS-CLIP
DIRECT
LncBasev2
EIF1P7
hsa-miR-33b-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000487533
Biotype: processed_pseudogene
Gene id: ENSG00000213772
Gene Name: EIF1P7
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-33b-3p
Sequence: cagugccucggcagugcagccc
MirBase ID: MIMAT0004811
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:9271547-9271575
exon
HITS-CLIP
DIRECT
LncBasev2
EIF4HP1
hsa-miR-33b-3p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000453115
Biotype: processed_pseudogene
Gene id: ENSG00000233830
Gene Name: EIF4HP1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-33b-3p
Sequence: cagugccucggcagugcagccc
MirBase ID: MIMAT0004811
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:27458535-27458563
exon
HITS-CLIP
DIRECT
LncBasev2
H19
hsa-miR-33b-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000414790
Biotype: lincRNA
Gene id: ENSG00000130600
Gene Name: H19
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-33b-3p
Sequence: cagugccucggcagugcagccc
MirBase ID: MIMAT0004811
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:1996603-1996631
exon
HITS-CLIP
DIRECT
LncBasev2
11:1995463-1995491
exon
HITS-CLIP
DIRECT
LncBasev2
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
11:1995463-1995491
exon
HITS-CLIP
DIRECT
LncBasev2
HLA-J
hsa-miR-33b-3p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000462773
Biotype: processed_transcript
Gene id: ENSG00000204622
Gene Name: HLA-J
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-33b-3p
Sequence: cagugccucggcagugcagccc
MirBase ID: MIMAT0004811
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCLBACD1
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:30009783-30009811
exon
PAR-CLIP
DIRECT
LncBasev2
HNRNPA1P35
hsa-miR-33b-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000429216
Biotype: processed_pseudogene
Gene id: ENSG00000225695
Gene Name: HNRNPA1P35
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-33b-3p
Sequence: cagugccucggcagugcagccc
MirBase ID: MIMAT0004811
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:201063487-201063515
exon
HITS-CLIP
DIRECT
LncBasev2
IPO7P1
hsa-miR-33b-3p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000442031
Biotype: processed_pseudogene
Gene id: ENSG00000232951
Gene Name: IPO7P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-33b-3p
Sequence: cagugccucggcagugcagccc
MirBase ID: MIMAT0004811
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:51922277-51922305
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00668
hsa-miR-33b-3p
IP

Gene Details
Chromosome: 18
Transcript: ENST00000580197
Biotype: lincRNA
Gene id: ENSG00000265933
Gene Name: LINC00668
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant

miRNA Details
Name: hsa-miR-33b-3p
Sequence: cagugccucggcagugcagccc
MirBase ID: MIMAT0004811
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
18:6925667-6925695
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00674
hsa-miR-33b-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000620266
Biotype: lincRNA
Gene id: ENSG00000278730
Gene Name: LINC00674
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-33b-3p
Sequence: cagugccucggcagugcagccc
MirBase ID: MIMAT0004811
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:68129278-68129306
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00963
hsa-miR-33b-3p
IP

Gene Details
Chromosome: 9
Transcript: ENST00000419300
Biotype: lincRNA
Gene id: ENSG00000204054
Gene Name: LINC00963
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-33b-3p
Sequence: cagugccucggcagugcagccc
MirBase ID: MIMAT0004811
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:129505373-129505401
exon
HITS-CLIP
DIRECT
LncBasev2
MALAT1
hsa-miR-33b-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000534336
Biotype: lincRNA
Gene id: ENSG00000251562
Gene Name: MALAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-33b-3p
Sequence: cagugccucggcagugcagccc
MirBase ID: MIMAT0004811
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65504112-65504140
exon
HITS-CLIP
DIRECT
LncBasev2
11:65503255-65503283
exon
HITS-CLIP
DIRECT
LncBasev2
11:65502921-65502949
exon
HITS-CLIP
DIRECT
LncBasev2
11:65502054-65502082
exon
HITS-CLIP
DIRECT
LncBasev2
11:65502054-65502082
exon
HITS-CLIP
DIRECT
LncBasev2
MEG3
hsa-miR-33b-3p
IP

Gene Details
Chromosome: 14
Transcript: ENST00000455531
Biotype: lincRNA
Gene id: ENSG00000214548
Gene Name: MEG3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-33b-3p
Sequence: cagugccucggcagugcagccc
MirBase ID: MIMAT0004811
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:100834464-100834492
exon
HITS-CLIP
DIRECT
LncBasev2
MRPL3P1
hsa-miR-33b-3p
-
IP

Gene Details
Chromosome: 13
Transcript: ENST00000400109
Biotype: processed_pseudogene
Gene id: ENSG00000215349
Gene Name: MRPL3P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-33b-3p
Sequence: cagugccucggcagugcagccc
MirBase ID: MIMAT0004811
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRNA.
Location
Region
Method
Result
Validation Type
Source
13:19305062-19305090
exon
HITS-CLIP
DIRECT
LncBasev2
MTND1P32
hsa-miR-33b-3p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000433043
Biotype: processed_pseudogene
Gene id: ENSG00000232282
Gene Name: MTND1P32
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-33b-3p
Sequence: cagugccucggcagugcagccc
MirBase ID: MIMAT0004811
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:102785819-102785847
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-33b-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000501122
Biotype: lincRNA
Gene id: ENSG00000245532
Gene Name: NEAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-33b-3p
Sequence: cagugccucggcagugcagccc
MirBase ID: MIMAT0004811
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
11:65438928-65438956
exon
HITS-CLIP
DIRECT
LncBasev2
11:65438158-65438186
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65436610-65436638
exon
HITS-CLIP
DIRECT
LncBasev2
11:65443359-65443387
exon
HITS-CLIP
DIRECT
LncBasev2
11:65435565-65435593
exon
HITS-CLIP
DIRECT
LncBasev2
Bone Marrow
HS27a
IP
Tested Cell Line: HS27a
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65443359-65443387
exon
HITS-CLIP
DIRECT
LncBasev2
11:65427161-65427189
exon
HITS-CLIP
DIRECT
LncBasev2
11:65427161-65427189
exon
HITS-CLIP
DIRECT
LncBasev2
11:65439790-65439818
exon
HITS-CLIP
DIRECT
LncBasev2
11:65443359-65443387
exon
HITS-CLIP
DIRECT
LncBasev2
11:65436610-65436638
exon
HITS-CLIP
DIRECT
LncBasev2
11:65430024-65430052
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: