Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-33b-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC004987.9
hsa-miR-33b-5p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000395959
Biotype: processed_pseudogene
Gene id: ENSG00000233225
Gene Name: AC004987.9
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-33b-5p
Sequence: gugcauugcuguugcauugc
MirBase ID: MIMAT0003301
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:39834145-39834173
exon
HITS-CLIP
DIRECT
LncBasev2
AC006024.4
hsa-miR-33b-5p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000428251
Biotype: processed_pseudogene
Gene id: ENSG00000218305
Gene Name: AC006024.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-33b-5p
Sequence: gugcauugcuguugcauugc
MirBase ID: MIMAT0003301
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:48925127-48925155
exon
HITS-CLIP
DIRECT
LncBasev2
AC007036.5
hsa-miR-33b-5p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000511893
Biotype: sense_overlapping
Gene id: ENSG00000251660
Gene Name: AC007036.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-33b-5p
Sequence: gugcauugcuguugcauugc
MirBase ID: MIMAT0003301
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:30159346-30159374
exon
HITS-CLIP
DIRECT
LncBasev2
AC016739.2
hsa-miR-33b-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000405359
Biotype: processed_pseudogene
Gene id: ENSG00000218175
Gene Name: AC016739.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-33b-5p
Sequence: gugcauugcuguugcauugc
MirBase ID: MIMAT0003301
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:176201063-176201091
exon
HITS-CLIP
DIRECT
LncBasev2
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:176201063-176201091
exon
HITS-CLIP
DIRECT
LncBasev2
AL845472.1
hsa-miR-33b-5p
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000624675
Biotype: pseudogene
Gene id: ENSG00000279561
Gene Name: AL845472.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-33b-5p
Sequence: gugcauugcuguugcauugc
MirBase ID: MIMAT0003301
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:41271519-41271547
exon
HITS-CLIP
DIRECT
LncBasev2
ANKRD36BP2
hsa-miR-33b-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000575193
Biotype: transcribed_unprocessed_pseudogene
Gene id: ENSG00000230006
Gene Name: ANKRD36BP2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-33b-5p
Sequence: gugcauugcuguugcauugc
MirBase ID: MIMAT0003301
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
2:88797410-88797438
exon
HITS-CLIP
DIRECT
LncBasev2
BIN3-IT1
hsa-miR-33b-5p
IP

Gene Details
Chromosome: 8
Transcript: NR_027715.1
Biotype: sense
Gene id: NR_027715.1 (gene)
Gene Name: BIN3-IT1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-33b-5p
Sequence: gugcauugcuguugcauugc
MirBase ID: MIMAT0003301
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
8:22641307-22641335
exon
HITS-CLIP
DIRECT
LncBasev2
C14orf132
hsa-miR-33b-5p
IP

Gene Details
Chromosome: 14
Transcript: ENST00000555004
Biotype: lincRNA
Gene id: ENSG00000227051
Gene Name: C14orf132
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-33b-5p
Sequence: gugcauugcuguugcauugc
MirBase ID: MIMAT0003301
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:96091967-96091995
exon
HITS-CLIP
DIRECT
LncBasev2
14:96092581-96092609
exon
HITS-CLIP
DIRECT
LncBasev2
CALML3-AS1
hsa-miR-33b-5p
IP

Gene Details
Chromosome: 10
Transcript: ENST00000543008
Biotype: antisense
Gene id: ENSG00000205488
Gene Name: CALML3-AS1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-33b-5p
Sequence: gugcauugcuguugcauugc
MirBase ID: MIMAT0003301
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
10:5516775-5516803
exon
HITS-CLIP
DIRECT
LncBasev2
CASC7
hsa-miR-33b-5p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-33b-5p
Sequence: gugcauugcuguugcauugc
MirBase ID: MIMAT0003301
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140526103-140526131
exon
HITS-CLIP
DIRECT
LncBasev2
8:140522156-140522184
exon
HITS-CLIP
DIRECT
LncBasev2
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140527358-140527386
exon
HITS-CLIP
DIRECT
LncBasev2
8:140526103-140526131
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140521946-140521974
exon
PAR-CLIP
DIRECT
LncBasev2
CLEC2D
hsa-miR-33b-5p
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000396690
Biotype: processed_pseudogene
Gene id: ENSG00000213443
Gene Name: CLEC2D
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-33b-5p
Sequence: gugcauugcuguugcauugc
MirBase ID: MIMAT0003301
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:9695931-9695959
exon
HITS-CLIP
DIRECT
LncBasev2
COPS5P1
hsa-miR-33b-5p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000415778
Biotype: processed_pseudogene
Gene id: ENSG00000213187
Gene Name: COPS5P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-33b-5p
Sequence: gugcauugcuguugcauugc
MirBase ID: MIMAT0003301
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:93092227-93092255
exon
HITS-CLIP
DIRECT
LncBasev2
COX17P1
hsa-miR-33b-5p
-
IP

Gene Details
Chromosome: 13
Transcript: ENST00000378775
Biotype: processed_pseudogene
Gene id: ENSG00000205105
Gene Name: COX17P1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-33b-5p
Sequence: gugcauugcuguugcauugc
MirBase ID: MIMAT0003301
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
13:46491068-46491096
exon
HITS-CLIP
DIRECT
LncBasev2
CTA-29F11.1
hsa-miR-33b-5p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000564152
Biotype: antisense
Gene id: ENSG00000260708
Gene Name: CTA-29F11.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-33b-5p
Sequence: gugcauugcuguugcauugc
MirBase ID: MIMAT0003301
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:46762204-46762232
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-158E9.2
hsa-miR-33b-5p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000520639
Biotype: processed_pseudogene
Gene id: ENSG00000253886
Gene Name: CTB-158E9.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-33b-5p
Sequence: gugcauugcuguugcauugc
MirBase ID: MIMAT0003301
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:154493853-154493881
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-89H12.4
hsa-miR-33b-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000499521
Biotype: retained_intron
Gene id: ENSG00000230551
Gene Name: CTB-89H12.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-33b-5p
Sequence: gugcauugcuguugcauugc
MirBase ID: MIMAT0003301
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCLBAC
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149494875-149494903
exon
PAR-CLIP
DIRECT
LncBasev2
5:149494875-149494903
exon
PAR-CLIP
DIRECT
LncBasev2
5:149494875-149494916
exon
PAR-CLIP
DIRECT
LncBasev2
5:149494875-149494903
exon
PAR-CLIP
DIRECT
LncBasev2
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149494875-149494916
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149494875-149494916
exon
PAR-CLIP
DIRECT
LncBasev2
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
5:149494875-149494916
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149494875-149494916
exon
HITS-CLIP
DIRECT
LncBasev2
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
5:149494875-149494916
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-205M6.5
hsa-miR-33b-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000562870
Biotype: sense_overlapping
Gene id: ENSG00000260841
Gene Name: CTC-205M6.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-33b-5p
Sequence: gugcauugcuguugcauugc
MirBase ID: MIMAT0003301
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:180785930-180785958
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-429P9.3
hsa-miR-33b-5p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000598112
Biotype: sense_intronic
Gene id: ENSG00000269044
Gene Name: CTC-429P9.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-33b-5p
Sequence: gugcauugcuguugcauugc
MirBase ID: MIMAT0003301
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:16633961-16633989
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-444N24.11
hsa-miR-33b-5p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000593427
Biotype: lincRNA
Gene id: ENSG00000268205
Gene Name: CTC-444N24.11
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-33b-5p
Sequence: gugcauugcuguugcauugc
MirBase ID: MIMAT0003301
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:57308495-57308523
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:57308495-57308523
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2008P7.1
hsa-miR-33b-5p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000564762
Biotype: lincRNA
Gene id: ENSG00000260777
Gene Name: CTD-2008P7.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Kidney Normal/Primary
- Lung Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary

miRNA Details
Name: hsa-miR-33b-5p
Sequence: gugcauugcuguugcauugc
MirBase ID: MIMAT0003301
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:28264705-28264733
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: