Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-34a-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC004840.9
hsa-miR-34a-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000313156
Biotype: lincRNA
Gene id: ENSG00000175873
Gene Name: AC004840.9
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary

miRNA Details
Name: hsa-miR-34a-3p
Sequence: caaucagcaaguauacugcccu
MirBase ID: MIMAT0004557
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:2446824-2446852
exon
HITS-CLIP
DIRECT
LncBasev2
AC007036.5
hsa-miR-34a-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000511893
Biotype: sense_overlapping
Gene id: ENSG00000251660
Gene Name: AC007036.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-34a-3p
Sequence: caaucagcaaguauacugcccu
MirBase ID: MIMAT0004557
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:30159007-30159035
exon
HITS-CLIP
DIRECT
LncBasev2
AC007038.7
hsa-miR-34a-3p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000452057
Biotype: antisense
Gene id: ENSG00000229127
Gene Name: AC007038.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-miR-34a-3p
Sequence: caaucagcaaguauacugcccu
MirBase ID: MIMAT0004557
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:210031147-210031175
exon
HITS-CLIP
DIRECT
LncBasev2
ARL4P
hsa-miR-34a-3p
-
IP

Gene Details
Chromosome: 10
Transcript: ENST00000503220
Biotype: processed_pseudogene
Gene id: ENSG00000122872
Gene Name: ARL4P
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34a-3p
Sequence: caaucagcaaguauacugcccu
MirBase ID: MIMAT0004557
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
10:60685101-60685129
exon
HITS-CLIP
DIRECT
LncBasev2
ATP6V0E1P3
hsa-miR-34a-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000420036
Biotype: processed_pseudogene
Gene id: ENSG00000238038
Gene Name: ATP6V0E1P3
UCSC graphic:
Expression:
  Cell Line Tissue Category
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-34a-3p
Sequence: caaucagcaaguauacugcccu
MirBase ID: MIMAT0004557
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
2:33602176-33602204
exon
HITS-CLIP
DIRECT
LncBasev2
BTN2A3P
hsa-miR-34a-3p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000466808
Biotype: processed_transcript
Gene id: ENSG00000124549
Gene Name: BTN2A3P
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-34a-3p
Sequence: caaucagcaaguauacugcccu
MirBase ID: MIMAT0004557
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
6:26432036-26432064
exon
HITS-CLIP
DIRECT
LncBasev2
C1orf132
hsa-miR-34a-3p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000608023
Biotype: lincRNA
Gene id: ENSG00000203709
Gene Name: C1orf132
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-34a-3p
Sequence: caaucagcaaguauacugcccu
MirBase ID: MIMAT0004557
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
1:207810492-207810520
exon
HITS-CLIP
DIRECT
LncBasev2
CASC7
hsa-miR-34a-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-34a-3p
Sequence: caaucagcaaguauacugcccu
MirBase ID: MIMAT0004557
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: EF3DAGO2
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140527457-140527485
exon
PAR-CLIP
DIRECT
LncBasev2
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140527457-140527485
exon
HITS-CLIP
DIRECT
LncBasev2
8:140527396-140527424
exon
HITS-CLIP
DIRECT
LncBasev2
CHKB-CPT1B
hsa-miR-34a-3p
IP

Gene Details
Chromosome: 22
Transcript: NR_027928.2
Biotype: sense
Gene id: NR_027928.2 (gene)
Gene Name: CHKB-CPT1B
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-34a-3p
Sequence: caaucagcaaguauacugcccu
MirBase ID: MIMAT0004557
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:50568931-50568959
exon
HITS-CLIP
DIRECT
LncBasev2
chr22-38_28785274-29006793.1
hsa-miR-34a-3p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34a-3p
Sequence: caaucagcaaguauacugcccu
MirBase ID: MIMAT0004557
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
22:28975904-28975932
exon
HITS-CLIP
DIRECT
LncBasev2
CTA-445C9.14
hsa-miR-34a-3p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000566814
Biotype: antisense
Gene id: ENSG00000261188
Gene Name: CTA-445C9.14
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-34a-3p
Sequence: caaucagcaaguauacugcccu
MirBase ID: MIMAT0004557
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:26514341-26514369
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-89H12.4
hsa-miR-34a-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000499521
Biotype: retained_intron
Gene id: ENSG00000230551
Gene Name: CTB-89H12.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-34a-3p
Sequence: caaucagcaaguauacugcccu
MirBase ID: MIMAT0004557
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
5:149495658-149495686
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-273B12.8
hsa-miR-34a-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000427476
Biotype: lincRNA
Gene id: ENSG00000269751
Gene Name: CTC-273B12.8
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-34a-3p
Sequence: caaucagcaaguauacugcccu
MirBase ID: MIMAT0004557
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
19:48479855-48479883
exon
HITS-CLIP
DIRECT
LncBasev2
19:48479855-48479883
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-444N24.11
hsa-miR-34a-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000593427
Biotype: lincRNA
Gene id: ENSG00000268205
Gene Name: CTC-444N24.11
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-34a-3p
Sequence: caaucagcaaguauacugcccu
MirBase ID: MIMAT0004557
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
19:57308446-57308474
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2313F11.1
hsa-miR-34a-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000609699
Biotype: antisense
Gene id: ENSG00000240535
Gene Name: CTD-2313F11.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-34a-3p
Sequence: caaucagcaaguauacugcccu
MirBase ID: MIMAT0004557
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
5:55036656-55036684
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-3234P18.6
hsa-miR-34a-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000611182
Biotype: lincRNA
Gene id: ENSG00000276071
Gene Name: CTD-3234P18.6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34a-3p
Sequence: caaucagcaaguauacugcccu
MirBase ID: MIMAT0004557
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:36668784-36668812
exon
HITS-CLIP
DIRECT
LncBasev2
DDX10P1
hsa-miR-34a-3p
-
IP

Gene Details
Chromosome: 10
Transcript: ENST00000448545
Biotype: processed_pseudogene
Gene id: ENSG00000237135
Gene Name: DDX10P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34a-3p
Sequence: caaucagcaaguauacugcccu
MirBase ID: MIMAT0004557
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
10:30920908-30920936
exon
HITS-CLIP
DIRECT
LncBasev2
DYX1C1-CCPG1
hsa-miR-34a-3p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000565113
Biotype: processed_transcript
Gene id: ENSG00000261771
Gene Name: DYX1C1-CCPG1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34a-3p
Sequence: caaucagcaaguauacugcccu
MirBase ID: MIMAT0004557
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:55360433-55360461
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P12
hsa-miR-34a-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000443590
Biotype: processed_pseudogene
Gene id: ENSG00000214199
Gene Name: EEF1A1P12
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-34a-3p
Sequence: caaucagcaaguauacugcccu
MirBase ID: MIMAT0004557
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:106698331-106698359
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P14
hsa-miR-34a-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000421195
Biotype: processed_pseudogene
Gene id: ENSG00000233057
Gene Name: EEF1A1P14
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-34a-3p
Sequence: caaucagcaaguauacugcccu
MirBase ID: MIMAT0004557
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:194189284-194189312
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: