Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-34b-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC007036.5
hsa-miR-34b-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000511893
Biotype: sense_overlapping
Gene id: ENSG00000251660
Gene Name: AC007036.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:30159007-30159035
exon
HITS-CLIP
DIRECT
LncBasev2
AC007038.7
hsa-miR-34b-3p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000452057
Biotype: antisense
Gene id: ENSG00000229127
Gene Name: AC007038.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:210031147-210031175
exon
HITS-CLIP
DIRECT
LncBasev2
AC009948.7
hsa-miR-34b-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000437039
Biotype: processed_pseudogene
Gene id: ENSG00000238082
Gene Name: AC009948.7
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:178454760-178454788
exon
HITS-CLIP
DIRECT
LncBasev2
CASC7
hsa-miR-34b-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140521125-140521153
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140528162-140528190
exon
HITS-CLIP
DIRECT
LncBasev2
CCT5P2
hsa-miR-34b-3p
-
IP

Gene Details
Chromosome: 13
Transcript: ENST00000432974
Biotype: processed_pseudogene
Gene id: ENSG00000230584
Gene Name: CCT5P2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
13:78909892-78909920
exon
HITS-CLIP
DIRECT
LncBasev2
CKMT2-AS1
hsa-miR-34b-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000501927
Biotype: antisense
Gene id: ENSG00000247572
Gene Name: CKMT2-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:81238538-81238566
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-50E14.5
hsa-miR-34b-3p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000600255
Biotype: processed_pseudogene
Gene id: ENSG00000269374
Gene Name: CTB-50E14.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:42485548-42485576
exon
HITS-CLIP
DIRECT
LncBasev2
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:42485548-42485576
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-89H12.4
hsa-miR-34b-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000499521
Biotype: retained_intron
Gene id: ENSG00000230551
Gene Name: CTB-89H12.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149495531-149495559
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-3234P18.6
hsa-miR-34b-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000611182
Biotype: lincRNA
Gene id: ENSG00000276071
Gene Name: CTD-3234P18.6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:36668768-36668796
exon
HITS-CLIP
DIRECT
LncBasev2
DDX10P1
hsa-miR-34b-3p
-
IP

Gene Details
Chromosome: 10
Transcript: ENST00000448545
Biotype: processed_pseudogene
Gene id: ENSG00000237135
Gene Name: DDX10P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
10:30920908-30920936
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P11
hsa-miR-34b-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000415278
Biotype: processed_pseudogene
Gene id: ENSG00000228502
Gene Name: EEF1A1P11
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:96447937-96447965
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P12
hsa-miR-34b-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000443590
Biotype: processed_pseudogene
Gene id: ENSG00000214199
Gene Name: EEF1A1P12
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:106698331-106698359
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P13
hsa-miR-34b-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000503537
Biotype: processed_pseudogene
Gene id: ENSG00000250182
Gene Name: EEF1A1P13
UCSC graphic:
Expression:
  Cell Line Tissue Category
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:14652291-14652319
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P14
hsa-miR-34b-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000421195
Biotype: processed_pseudogene
Gene id: ENSG00000233057
Gene Name: EEF1A1P14
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:194189284-194189312
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P38
hsa-miR-34b-3p
-
IP

Gene Details
Chromosome: 16
Transcript: ENST00000567658
Biotype: processed_pseudogene
Gene id: ENSG00000261557
Gene Name: EEF1A1P38
UCSC graphic:
Expression:
  Cell Line Tissue Category
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
16:27134834-27134862
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P8
hsa-miR-34b-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000419025
Biotype: processed_pseudogene
Gene id: ENSG00000223529
Gene Name: EEF1A1P8
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:184027410-184027438
exon
HITS-CLIP
DIRECT
LncBasev2
HDAC1P2
hsa-miR-34b-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000453661
Biotype: transcribed_processed_pseudogene
Gene id: ENSG00000233012
Gene Name: HDAC1P2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:220627127-220627155
exon
HITS-CLIP
DIRECT
LncBasev2
HINT1P1
hsa-miR-34b-3p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000464866
Biotype: processed_pseudogene
Gene id: ENSG00000231531
Gene Name: HINT1P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:143312824-143312852
exon
HITS-CLIP
DIRECT
LncBasev2
HNRNPA1P35
hsa-miR-34b-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000429216
Biotype: processed_pseudogene
Gene id: ENSG00000225695
Gene Name: HNRNPA1P35
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:201063463-201063491
exon
HITS-CLIP
DIRECT
LncBasev2
HSP90B2P
hsa-miR-34b-3p
-
IP

Gene Details
Chromosome: 15
Transcript: ENST00000559111
Biotype: processed_pseudogene
Gene id: ENSG00000259706
Gene Name: HSP90B2P
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:99258169-99258197
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: