Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-34b-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
ABHD14A-ACY1
hsa-miR-34b-5p
IP

Gene Details
Chromosome: 3
Transcript: NR_037192.1
Biotype: sense
Gene id: NR_037192.1 (gene)
Gene Name: ABHD14A-ACY1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-34b-5p
Sequence: uaggcagugucauuagcugauug
MirBase ID: MIMAT0000685
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:51989009-51989037
exon
HITS-CLIP
DIRECT
LncBasev2
AC000089.3
hsa-miR-34b-5p
-
IP

Gene Details
Chromosome: 22
Transcript: ENST00000424559
Biotype: processed_pseudogene
Gene id: ENSG00000235776
Gene Name: AC000089.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34b-5p
Sequence: uaggcagugucauuagcugauug
MirBase ID: MIMAT0000685
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
22:19792783-19792811
exon
HITS-CLIP
DIRECT
LncBasev2
AC007246.3
hsa-miR-34b-5p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000446698
Biotype: antisense
Gene id: ENSG00000231312
Gene Name: AC007246.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-34b-5p
Sequence: uaggcagugucauuagcugauug
MirBase ID: MIMAT0000685
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
2:39624207-39624235
exon
HITS-CLIP
DIRECT
LncBasev2
AC010761.6
hsa-miR-34b-5p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000584779
Biotype: antisense
Gene id: ENSG00000265073
Gene Name: AC010761.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-34b-5p
Sequence: uaggcagugucauuagcugauug
MirBase ID: MIMAT0000685
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
17:28742495-28742523
exon
HITS-CLIP
DIRECT
LncBasev2
AC079325.6
hsa-miR-34b-5p
-
IP

Gene Details
Chromosome: 17
Transcript: ENST00000425002
Biotype: unprocessed_pseudogene
Gene id: ENSG00000231027
Gene Name: AC079325.6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34b-5p
Sequence: uaggcagugucauuagcugauug
MirBase ID: MIMAT0000685
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
17:74567310-74567338
exon
HITS-CLIP
DIRECT
LncBasev2
AC087294.2
hsa-miR-34b-5p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000580291
Biotype: antisense
Gene id: ENSG00000235530
Gene Name: AC087294.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-34b-5p
Sequence: uaggcagugucauuagcugauug
MirBase ID: MIMAT0000685
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
17:21218206-21218234
exon
HITS-CLIP
DIRECT
LncBasev2
AC090587.2
hsa-miR-34b-5p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000507938
Biotype: sense_overlapping
Gene id: ENSG00000250404
Gene Name: AC090587.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-miR-34b-5p
Sequence: uaggcagugucauuagcugauug
MirBase ID: MIMAT0000685
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
11:3817185-3817213
exon
HITS-CLIP
DIRECT
LncBasev2
AC093838.4
hsa-miR-34b-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000438378
Biotype: processed_transcript
Gene id: ENSG00000152117
Gene Name: AC093838.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-34b-5p
Sequence: uaggcagugucauuagcugauug
MirBase ID: MIMAT0000685
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
2:131500554-131500582
exon
HITS-CLIP
DIRECT
LncBasev2
AP001429.1
hsa-miR-34b-5p
IP

Gene Details
Chromosome: 21
Transcript: ENST00000602568
Biotype: sense_intronic
Gene id: ENSG00000270116
Gene Name: AP001429.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-34b-5p
Sequence: uaggcagugucauuagcugauug
MirBase ID: MIMAT0000685
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
21:37101183-37101211
exon
HITS-CLIP
DIRECT
LncBasev2
AP006621.8
hsa-miR-34b-5p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000532946
Biotype: antisense
Gene id: ENSG00000255108
Gene Name: AP006621.8
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34b-5p
Sequence: uaggcagugucauuagcugauug
MirBase ID: MIMAT0000685
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
11:823765-823793
exon
HITS-CLIP
DIRECT
LncBasev2
BCORP1
hsa-miR-34b-5p
-
IP

Gene Details
Chromosome: Y
Transcript: ENST00000513194
Biotype: transcribed_unprocessed_pseudogene
Gene id: ENSG00000215580
Gene Name: BCORP1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34b-5p
Sequence: uaggcagugucauuagcugauug
MirBase ID: MIMAT0000685
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
Y:19467206-19467234
exon
HITS-CLIP
DIRECT
LncBasev2
BMS1P8
hsa-miR-34b-5p
-
IP

Gene Details
Chromosome: 16
Transcript: ENST00000567036
Biotype: processed_transcript
Gene id: ENSG00000260518
Gene Name: BMS1P8
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-34b-5p
Sequence: uaggcagugucauuagcugauug
MirBase ID: MIMAT0000685
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
16:33687078-33687106
exon
HITS-CLIP
DIRECT
LncBasev2
C1orf132
hsa-miR-34b-5p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000608023
Biotype: lincRNA
Gene id: ENSG00000203709
Gene Name: C1orf132
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-34b-5p
Sequence: uaggcagugucauuagcugauug
MirBase ID: MIMAT0000685
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
1:207812507-207812535
exon
HITS-CLIP
DIRECT
LncBasev2
C1orf220
hsa-miR-34b-5p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000521244
Biotype: lincRNA
Gene id: ENSG00000213057
Gene Name: C1orf220
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant

miRNA Details
Name: hsa-miR-34b-5p
Sequence: uaggcagugucauuagcugauug
MirBase ID: MIMAT0000685
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
1:178545567-178545595
exon
HITS-CLIP
DIRECT
LncBasev2
CCDC183-AS1
hsa-miR-34b-5p
IP

Gene Details
Chromosome: 9
Transcript: ENST00000414656
Biotype: antisense
Gene id: ENSG00000228544
Gene Name: CCDC183-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-miR-34b-5p
Sequence: uaggcagugucauuagcugauug
MirBase ID: MIMAT0000685
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
9:136804248-136804276
exon
HITS-CLIP
DIRECT
LncBasev2
CTA-280A3.2
hsa-miR-34b-5p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623760
Biotype: lincRNA
Gene id: ENSG00000279712
Gene Name: CTA-280A3.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34b-5p
Sequence: uaggcagugucauuagcugauug
MirBase ID: MIMAT0000685
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
22:47919046-47919074
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-31N19.3
hsa-miR-34b-5p
IP

Gene Details
Chromosome: 16
Transcript: ENST00000564271
Biotype: sense_intronic
Gene id: ENSG00000261596
Gene Name: CTB-31N19.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
hMSC-BM Bone Marrow Stem/Progenitor
HepG2 Liver Cancer/Malignant

miRNA Details
Name: hsa-miR-34b-5p
Sequence: uaggcagugucauuagcugauug
MirBase ID: MIMAT0000685
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
16:21626998-21627026
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-548K16.6
hsa-miR-34b-5p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000589702
Biotype: sense_intronic
Gene id: ENSG00000267474
Gene Name: CTC-548K16.6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34b-5p
Sequence: uaggcagugucauuagcugauug
MirBase ID: MIMAT0000685
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
19:14458689-14458717
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.7
hsa-miR-34b-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000534918
Biotype: retained_intron
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-34b-5p
Sequence: uaggcagugucauuagcugauug
MirBase ID: MIMAT0000685
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
5:479164-479192
exon
HITS-CLIP
DIRECT
LncBasev2
5:479164-479192
exon
HITS-CLIP
DIRECT
LncBasev2
5:479431-479459
exon
HITS-CLIP
DIRECT
LncBasev2
5:479431-479459
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2530N21.5
hsa-miR-34b-5p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000619681
Biotype: sense_overlapping
Gene id: ENSG00000177725
Gene Name: CTD-2530N21.5
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34b-5p
Sequence: uaggcagugucauuagcugauug
MirBase ID: MIMAT0000685
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
8:22170147-22170175
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: