Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-34c-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
CASC7
hsa-miR-34c-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-34c-3p
Sequence: aaucacuaaccacacggccagg
MirBase ID: MIMAT0004677
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140528163-140528191
exon
HITS-CLIP
DIRECT
LncBasev2
CKMT2-AS1
hsa-miR-34c-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000501927
Biotype: antisense
Gene id: ENSG00000247572
Gene Name: CKMT2-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-34c-3p
Sequence: aaucacuaaccacacggccagg
MirBase ID: MIMAT0004677
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:81238539-81238567
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-89H12.4
hsa-miR-34c-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000499521
Biotype: retained_intron
Gene id: ENSG00000230551
Gene Name: CTB-89H12.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-34c-3p
Sequence: aaucacuaaccacacggccagg
MirBase ID: MIMAT0004677
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149498792-149498820
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-3234P18.6
hsa-miR-34c-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000611182
Biotype: lincRNA
Gene id: ENSG00000276071
Gene Name: CTD-3234P18.6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34c-3p
Sequence: aaucacuaaccacacggccagg
MirBase ID: MIMAT0004677
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:36668767-36668795
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P11
hsa-miR-34c-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000415278
Biotype: processed_pseudogene
Gene id: ENSG00000228502
Gene Name: EEF1A1P11
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-34c-3p
Sequence: aaucacuaaccacacggccagg
MirBase ID: MIMAT0004677
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:96447936-96447964
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P13
hsa-miR-34c-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000503537
Biotype: processed_pseudogene
Gene id: ENSG00000250182
Gene Name: EEF1A1P13
UCSC graphic:
Expression:
  Cell Line Tissue Category
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-34c-3p
Sequence: aaucacuaaccacacggccagg
MirBase ID: MIMAT0004677
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:14652292-14652320
exon
HITS-CLIP
DIRECT
LncBasev2
FLJ42393
hsa-miR-34c-3p
IP

Gene Details
Chromosome: 3
Transcript: NR_024413.1
Biotype: sense
Gene id: NR_024413.1 (gene)
Gene Name: FLJ42393
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-34c-3p
Sequence: aaucacuaaccacacggccagg
MirBase ID: MIMAT0004677
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:188179949-188179977
exon
HITS-CLIP
DIRECT
LncBasev2
HDAC1P2
hsa-miR-34c-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000453661
Biotype: transcribed_processed_pseudogene
Gene id: ENSG00000233012
Gene Name: HDAC1P2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34c-3p
Sequence: aaucacuaaccacacggccagg
MirBase ID: MIMAT0004677
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:220627126-220627154
exon
HITS-CLIP
DIRECT
LncBasev2
HNRNPA1P35
hsa-miR-34c-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000429216
Biotype: processed_pseudogene
Gene id: ENSG00000225695
Gene Name: HNRNPA1P35
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34c-3p
Sequence: aaucacuaaccacacggccagg
MirBase ID: MIMAT0004677
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:201063462-201063490
exon
HITS-CLIP
DIRECT
LncBasev2
HOXA10-HOXA9
hsa-miR-34c-3p
IP

Gene Details
Chromosome: 7
Transcript: NR_037940.1
Biotype: sense
Gene id: NR_037940.1 (gene)
Gene Name: HOXA10-HOXA9
UCSC graphic: -
Expression: -

miRNA Details
Name: hsa-miR-34c-3p
Sequence: aaucacuaaccacacggccagg
MirBase ID: MIMAT0004677
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:27163077-27163105
exon
HITS-CLIP
DIRECT
LncBasev2
HSP90B3P
hsa-miR-34c-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000415545
Biotype: processed_pseudogene
Gene id: ENSG00000203914
Gene Name: HSP90B3P
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34c-3p
Sequence: aaucacuaaccacacggccagg
MirBase ID: MIMAT0004677
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:91643033-91643061
exon
HITS-CLIP
DIRECT
LncBasev2
IPO7P1
hsa-miR-34c-3p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000442031
Biotype: processed_pseudogene
Gene id: ENSG00000232951
Gene Name: IPO7P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34c-3p
Sequence: aaucacuaaccacacggccagg
MirBase ID: MIMAT0004677
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:51922267-51922295
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00511
hsa-miR-34c-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000457958
Biotype: lincRNA
Gene id: ENSG00000227036
Gene Name: LINC00511
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-34c-3p
Sequence: aaucacuaaccacacggccagg
MirBase ID: MIMAT0004677
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:72404430-72404458
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00657
hsa-miR-34c-3p
IP

Gene Details
Chromosome: 20
Transcript: ENST00000565493
Biotype: lincRNA
Gene id: ENSG00000260032
Gene Name: LINC00657
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-34c-3p
Sequence: aaucacuaaccacacggccagg
MirBase ID: MIMAT0004677
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
20:36045713-36045741
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00900
hsa-miR-34c-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000499809
Biotype: lincRNA
Gene id: ENSG00000246100
Gene Name: LINC00900
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary

miRNA Details
Name: hsa-miR-34c-3p
Sequence: aaucacuaaccacacggccagg
MirBase ID: MIMAT0004677
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:115756712-115756740
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00900
hsa-miR-34c-3p
IP

Gene Details
Chromosome: 11
Transcript: NR_034148.1
Biotype: lincRNA
Gene id: NR_034148.1 (gene)
Gene Name: LINC00900
UCSC graphic: -
Expression: -

miRNA Details
Name: hsa-miR-34c-3p
Sequence: aaucacuaaccacacggccagg
MirBase ID: MIMAT0004677
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:115756712-115756740
exon
HITS-CLIP
DIRECT
LncBasev2
MALAT1
hsa-miR-34c-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000534336
Biotype: lincRNA
Gene id: ENSG00000251562
Gene Name: MALAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-34c-3p
Sequence: aaucacuaaccacacggccagg
MirBase ID: MIMAT0004677
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65504534-65504562
exon
HITS-CLIP
DIRECT
LncBasev2
11:65503807-65503835
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504727-65504755
exon
HITS-CLIP
DIRECT
LncBasev2
11:65503352-65503380
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504452-65504509
exon
HITS-CLIP
DIRECT
LncBasev2
11:65503957-65503985
exon
HITS-CLIP
DIRECT
LncBasev2
11:65503419-65503447
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504452-65504480
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504727-65504755
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504534-65504562
exon
HITS-CLIP
DIRECT
LncBasev2
MEG8
hsa-miR-34c-3p
-
IP

Gene Details
Chromosome: 14
Transcript: ENST00000556475
Biotype: lincRNA
Gene id: ENSG00000258399
Gene Name: MEG8
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-34c-3p
Sequence: aaucacuaaccacacggccagg
MirBase ID: MIMAT0004677
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:100935974-100936002
exon
HITS-CLIP
DIRECT
LncBasev2
MKLN1-AS
hsa-miR-34c-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000429067
Biotype: antisense
Gene id: ENSG00000236753
Gene Name: MKLN1-AS
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-34c-3p
Sequence: aaucacuaaccacacggccagg
MirBase ID: MIMAT0004677
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:131310462-131310490
exon
HITS-CLIP
DIRECT
LncBasev2
MTATP6P1
hsa-miR-34c-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000514057
Biotype: unprocessed_pseudogene
Gene id: ENSG00000248527
Gene Name: MTATP6P1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-34c-3p
Sequence: aaucacuaaccacacggccagg
MirBase ID: MIMAT0004677
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
HS27a
IP
Tested Cell Line: HS27a
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:634009-634037
exon
HITS-CLIP
DIRECT
LncBasev2
1:634009-634037
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:634009-634037
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: