Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-4691-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC009120.6
hsa-miR-4691-3p
IP

Gene Details
Chromosome: 16
Transcript: ENST00000621548
Biotype: lincRNA
Gene id: ENSG00000259972
Gene Name: AC009120.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-4691-3p
Sequence: ccagccacggacugagagugcau
MirBase ID: MIMAT0019782
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
16:74306342-74306370
exon
HITS-CLIP
DIRECT
LncBasev2
AC012309.5
hsa-miR-4691-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000592712
Biotype: lincRNA
Gene id: ENSG00000226686
Gene Name: AC012309.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-4691-3p
Sequence: ccagccacggacugagagugcau
MirBase ID: MIMAT0019782
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:37263197-37263225
exon
HITS-CLIP
DIRECT
LncBasev2
AC016739.2
hsa-miR-4691-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000405359
Biotype: processed_pseudogene
Gene id: ENSG00000218175
Gene Name: AC016739.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-4691-3p
Sequence: ccagccacggacugagagugcau
MirBase ID: MIMAT0019782
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:176201056-176201084
exon
HITS-CLIP
DIRECT
LncBasev2
AF131215.9
hsa-miR-4691-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000602575
Biotype: sense_intronic
Gene id: ENSG00000269918
Gene Name: AF131215.9
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-4691-3p
Sequence: ccagccacggacugagagugcau
MirBase ID: MIMAT0019782
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:11105752-11105780
exon
HITS-CLIP
DIRECT
LncBasev2
ALOX12P2
hsa-miR-4691-3p
-
IP

Gene Details
Chromosome: 17
Transcript: ENST00000574727
Biotype: processed_transcript
Gene id: ENSG00000262943
Gene Name: ALOX12P2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-4691-3p
Sequence: ccagccacggacugagagugcau
MirBase ID: MIMAT0019782
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:6901894-6901922
exon
HITS-CLIP
DIRECT
LncBasev2
CEBPZ-AS1
hsa-miR-4691-3p
IP

Gene Details
Chromosome: 2
Transcript: NR_037879.1
Biotype: sense
Gene id: NR_037879.1 (gene)
Gene Name: CEBPZ-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-4691-3p
Sequence: ccagccacggacugagagugcau
MirBase ID: MIMAT0019782
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:37202947-37202975
exon
HITS-CLIP
DIRECT
LncBasev2
CH17-12M21.1
hsa-miR-4691-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000512165
Biotype: processed_pseudogene
Gene id: ENSG00000176183
Gene Name: CH17-12M21.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-4691-3p
Sequence: ccagccacggacugagagugcau
MirBase ID: MIMAT0019782
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:98339244-98339272
exon
HITS-CLIP
DIRECT
LncBasev2
chr22-38_28785274-29006793.1
hsa-miR-4691-3p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-4691-3p
Sequence: ccagccacggacugagagugcau
MirBase ID: MIMAT0019782
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:29054647-29054675
exon
HITS-CLIP
DIRECT
LncBasev2
CROCCP3
hsa-miR-4691-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000263511
Biotype: processed_transcript
Gene id: ENSG00000080947
Gene Name: CROCCP3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-4691-3p
Sequence: ccagccacggacugagagugcau
MirBase ID: MIMAT0019782
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:16490881-16490909
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-205M6.5
hsa-miR-4691-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000562870
Biotype: sense_overlapping
Gene id: ENSG00000260841
Gene Name: CTC-205M6.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-4691-3p
Sequence: ccagccacggacugagagugcau
MirBase ID: MIMAT0019782
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:180785955-180785983
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-470E21.1
hsa-miR-4691-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000513509
Biotype: processed_pseudogene
Gene id: ENSG00000248350
Gene Name: CTC-470E21.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-4691-3p
Sequence: ccagccacggacugagagugcau
MirBase ID: MIMAT0019782
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:112363659-112363687
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2538A21.1
hsa-miR-4691-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000507713
Biotype: processed_pseudogene
Gene id: ENSG00000225165
Gene Name: CTD-2538A21.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-4691-3p
Sequence: ccagccacggacugagagugcau
MirBase ID: MIMAT0019782
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:95440337-95440365
exon
HITS-CLIP
DIRECT
LncBasev2
CYCSP23
hsa-miR-4691-3p
-
IP

Gene Details
Chromosome: 8
Transcript: ENST00000519781
Biotype: processed_pseudogene
Gene id: ENSG00000253495
Gene Name: CYCSP23
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-4691-3p
Sequence: ccagccacggacugagagugcau
MirBase ID: MIMAT0019782
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:119618386-119618414
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P13
hsa-miR-4691-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000503537
Biotype: processed_pseudogene
Gene id: ENSG00000250182
Gene Name: EEF1A1P13
UCSC graphic:
Expression:
  Cell Line Tissue Category
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-4691-3p
Sequence: ccagccacggacugagagugcau
MirBase ID: MIMAT0019782
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:14652347-14652375
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P19
hsa-miR-4691-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000513637
Biotype: processed_pseudogene
Gene id: ENSG00000249855
Gene Name: EEF1A1P19
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-4691-3p
Sequence: ccagccacggacugagagugcau
MirBase ID: MIMAT0019782
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:43495479-43495507
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P9
hsa-miR-4691-3p
-
IP

Gene Details
Chromosome: 4
Transcript: ENST00000514975
Biotype: processed_pseudogene
Gene id: ENSG00000249264
Gene Name: EEF1A1P9
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-4691-3p
Sequence: ccagccacggacugagagugcau
MirBase ID: MIMAT0019782
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:105485643-105485671
exon
HITS-CLIP
DIRECT
LncBasev2
EPB41L4A-AS1
hsa-miR-4691-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000413221
Biotype: lincRNA
Gene id: ENSG00000224032
Gene Name: EPB41L4A-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-4691-3p
Sequence: ccagccacggacugagagugcau
MirBase ID: MIMAT0019782
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:112160904-112160932
exon
HITS-CLIP
DIRECT
LncBasev2
EPB41L4A-AS1
hsa-miR-4691-3p
IP

Gene Details
Chromosome: 5
Transcript: NR_015370.2
Biotype: antisense
Gene id: NR_015370.2 (gene)
Gene Name: EPB41L4A-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-4691-3p
Sequence: ccagccacggacugagagugcau
MirBase ID: MIMAT0019782
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:112160904-112160932
exon
HITS-CLIP
DIRECT
LncBasev2
FAM115B
hsa-miR-4691-3p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000414990
Biotype: unprocessed_pseudogene
Gene id: ENSG00000223459
Gene Name: FAM115B
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-4691-3p
Sequence: ccagccacggacugagagugcau
MirBase ID: MIMAT0019782
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:143598270-143598298
exon
HITS-CLIP
DIRECT
LncBasev2
FAM60BP
hsa-miR-4691-3p
-
IP

Gene Details
Chromosome: 18
Transcript: ENST00000578364
Biotype: processed_pseudogene
Gene id: ENSG00000263829
Gene Name: FAM60BP
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-4691-3p
Sequence: ccagccacggacugagagugcau
MirBase ID: MIMAT0019782
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
18:26256109-26256137
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: