Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-4786-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC004840.9
hsa-miR-4786-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000313156
Biotype: lincRNA
Gene id: ENSG00000175873
Gene Name: AC004840.9
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary

miRNA Details
Name: hsa-miR-4786-3p
Sequence: ugaagccagcucuggucugggc
MirBase ID: MIMAT0019955
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:2446975-2447003
exon
HITS-CLIP
DIRECT
LncBasev2
7:2446834-2446862
exon
HITS-CLIP
DIRECT
LncBasev2
AC009299.5
hsa-miR-4786-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000482477
Biotype: processed_pseudogene
Gene id: ENSG00000232320
Gene Name: AC009299.5
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-4786-3p
Sequence: ugaagccagcucuggucugggc
MirBase ID: MIMAT0019955
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
2:161340909-161340937
exon
HITS-CLIP
DIRECT
LncBasev2
AC079325.6
hsa-miR-4786-3p
-
IP

Gene Details
Chromosome: 17
Transcript: ENST00000425002
Biotype: unprocessed_pseudogene
Gene id: ENSG00000231027
Gene Name: AC079325.6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-4786-3p
Sequence: ugaagccagcucuggucugggc
MirBase ID: MIMAT0019955
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
17:74567308-74567336
exon
HITS-CLIP
DIRECT
LncBasev2
AC092667.2
hsa-miR-4786-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000434301
Biotype: antisense
Gene id: ENSG00000230393
Gene Name: AC092667.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-4786-3p
Sequence: ugaagccagcucuggucugggc
MirBase ID: MIMAT0019955
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
2:100106635-100106663
exon
HITS-CLIP
DIRECT
LncBasev2
AC093323.3
hsa-miR-4786-3p
IP

Gene Details
Chromosome: 4
Transcript: ENST00000307533
Biotype: lincRNA
Gene id: ENSG00000170846
Gene Name: AC093323.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-4786-3p
Sequence: ugaagccagcucuggucugggc
MirBase ID: MIMAT0019955
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
4:6675787-6675815
exon
HITS-CLIP
DIRECT
LncBasev2
AC135048.13
hsa-miR-4786-3p
IP

Gene Details
Chromosome: 16
Transcript: ENST00000566056
Biotype: processed_transcript
Gene id: ENSG00000261487
Gene Name: AC135048.13
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-4786-3p
Sequence: ugaagccagcucuggucugggc
MirBase ID: MIMAT0019955
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
16:30948437-30948465
exon
HITS-CLIP
DIRECT
LncBasev2
ANP32A-IT1
hsa-miR-4786-3p
IP

Gene Details
Chromosome: 15
Transcript: NR_026808.1
Biotype: sense
Gene id: NR_026808.1 (gene)
Gene Name: ANP32A-IT1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-4786-3p
Sequence: ugaagccagcucuggucugggc
MirBase ID: MIMAT0019955
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
15:68806514-68806542
exon
HITS-CLIP
DIRECT
LncBasev2
ATXN8OS
hsa-miR-4786-3p
IP

Gene Details
Chromosome: 13
Transcript: ENST00000414504
Biotype: antisense
Gene id: ENSG00000230223
Gene Name: ATXN8OS
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-4786-3p
Sequence: ugaagccagcucuggucugggc
MirBase ID: MIMAT0019955
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
13:70107463-70107491
exon
HITS-CLIP
DIRECT
LncBasev2
ATXN8OS
hsa-miR-4786-3p
-
IP

Gene Details
Chromosome: 13
Transcript: NR_002717.2
Biotype: antisense
Gene id: NR_002717.2 (gene)
Gene Name: ATXN8OS
UCSC graphic: -
Expression: -

miRNA Details
Name: hsa-miR-4786-3p
Sequence: ugaagccagcucuggucugggc
MirBase ID: MIMAT0019955
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
13:70107463-70107491
exon
HITS-CLIP
DIRECT
LncBasev2
BTF3P4
hsa-miR-4786-3p
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000418852
Biotype: processed_pseudogene
Gene id: ENSG00000224820
Gene Name: BTF3P4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-4786-3p
Sequence: ugaagccagcucuggucugggc
MirBase ID: MIMAT0019955
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
9:72107837-72107865
exon
HITS-CLIP
DIRECT
LncBasev2
chr22-38_28785274-29006793.1
hsa-miR-4786-3p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-4786-3p
Sequence: ugaagccagcucuggucugggc
MirBase ID: MIMAT0019955
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
22:28930921-28930949
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-89H12.4
hsa-miR-4786-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000499521
Biotype: retained_intron
Gene id: ENSG00000230551
Gene Name: CTB-89H12.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-4786-3p
Sequence: ugaagccagcucuggucugggc
MirBase ID: MIMAT0019955
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
5:149497570-149497598
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-459F4.3
hsa-miR-4786-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000588784
Biotype: lincRNA
Gene id: ENSG00000267575
Gene Name: CTC-459F4.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-4786-3p
Sequence: ugaagccagcucuggucugggc
MirBase ID: MIMAT0019955
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
19:27795824-27795852
exon
HITS-CLIP
DIRECT
LncBasev2
GLTPP1
hsa-miR-4786-3p
-
IP

Gene Details
Chromosome: 11
Transcript: ENST00000528859
Biotype: processed_pseudogene
Gene id: ENSG00000255138
Gene Name: GLTPP1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-4786-3p
Sequence: ugaagccagcucuggucugggc
MirBase ID: MIMAT0019955
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
11:18189281-18189309
exon
HITS-CLIP
DIRECT
LncBasev2
HOXA10-HOXA9
hsa-miR-4786-3p
IP

Gene Details
Chromosome: 7
Transcript: NR_037940.1
Biotype: sense
Gene id: NR_037940.1 (gene)
Gene Name: HOXA10-HOXA9
UCSC graphic: -
Expression: -

miRNA Details
Name: hsa-miR-4786-3p
Sequence: ugaagccagcucuggucugggc
MirBase ID: MIMAT0019955
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:hippuristanol
Location
Region
Method
Result
Validation Type
Source
7:27163817-27163845
exon
HITS-CLIP
DIRECT
LncBasev2
ILF2P1
hsa-miR-4786-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000486302
Biotype: processed_pseudogene
Gene id: ENSG00000244226
Gene Name: ILF2P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-4786-3p
Sequence: ugaagccagcucuggucugggc
MirBase ID: MIMAT0019955
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
3:65688250-65688278
exon
HITS-CLIP
DIRECT
LncBasev2
KCNQ1OT1
hsa-miR-4786-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000597346
Biotype: antisense
Gene id: ENSG00000269821
Gene Name: KCNQ1OT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-4786-3p
Sequence: ugaagccagcucuggucugggc
MirBase ID: MIMAT0019955
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
11:2670577-2670605
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00086
hsa-miR-4786-3p
IP

Gene Details
Chromosome: X
Transcript: ENST00000417443
Biotype: lincRNA
Gene id: ENSG00000178947
Gene Name: LINC00086
UCSC graphic:
Expression:
  Cell Line Tissue Category
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-4786-3p
Sequence: ugaagccagcucuggucugggc
MirBase ID: MIMAT0019955
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
X:135425342-135425370
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00086
hsa-miR-4786-3p
IP

Gene Details
Chromosome: X
Transcript: NR_024359.1
Biotype: lincRNA
Gene id: NR_024359.1 (gene)
Gene Name: LINC00086
UCSC graphic: -
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-4786-3p
Sequence: ugaagccagcucuggucugggc
MirBase ID: MIMAT0019955
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
X:135425342-135425370
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00910
hsa-miR-4786-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000586231
Biotype: lincRNA
Gene id: ENSG00000188825
Gene Name: LINC00910
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-4786-3p
Sequence: ugaagccagcucuggucugggc
MirBase ID: MIMAT0019955
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
17:43388956-43388984
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: