Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-5096

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
NNT-AS1
hsa-miR-5096
IP

Gene Details
Chromosome: 5
Transcript: ENST00000513560
Biotype: antisense
Gene id: ENSG00000248092
Gene Name: NNT-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-5096
Sequence: guuucaccauguuggucaggc
MirBase ID: MIMAT0020603
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: EF3DAGO2
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:43572827-43572855
exon
PAR-CLIP
DIRECT
LncBasev2
RP5-1014D13.2
hsa-miR-5096
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623726
Biotype: sense_overlapping
Gene id: ENSG00000279738
Gene Name: RP5-1014D13.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-5096
Sequence: guuucaccauguuggucaggc
MirBase ID: MIMAT0020603
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCLBACD1
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:37877536-37877564
exon
PAR-CLIP
DIRECT
LncBasev2
Funded by: