Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-512-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
CTB-89H12.4
hsa-miR-512-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000499521
Biotype: retained_intron
Gene id: ENSG00000230551
Gene Name: CTB-89H12.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-512-5p
Sequence: cacucagccuugagggcacuuuc
MirBase ID: MIMAT0002822
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149496666-149496694
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2160D9.1
hsa-miR-512-5p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000511386
Biotype: processed_pseudogene
Gene id: ENSG00000250391
Gene Name: CTD-2160D9.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-512-5p
Sequence: cacucagccuugagggcacuuuc
MirBase ID: MIMAT0002822
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:99948782-99948810
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P12
hsa-miR-512-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000443590
Biotype: processed_pseudogene
Gene id: ENSG00000214199
Gene Name: EEF1A1P12
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-512-5p
Sequence: cacucagccuugagggcacuuuc
MirBase ID: MIMAT0002822
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:106698477-106698505
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P13
hsa-miR-512-5p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000503537
Biotype: processed_pseudogene
Gene id: ENSG00000250182
Gene Name: EEF1A1P13
UCSC graphic:
Expression:
  Cell Line Tissue Category
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-512-5p
Sequence: cacucagccuugagggcacuuuc
MirBase ID: MIMAT0002822
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:14652995-14653023
exon
HITS-CLIP
DIRECT
LncBasev2
GAPDHP1
hsa-miR-512-5p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000452570
Biotype: processed_pseudogene
Gene id: ENSG00000228232
Gene Name: GAPDHP1
UCSC graphic:
Expression:
  Cell Line Tissue Category
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-512-5p
Sequence: cacucagccuugagggcacuuuc
MirBase ID: MIMAT0002822
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:39787856-39787884
exon
HITS-CLIP
DIRECT
LncBasev2
GAS5
hsa-miR-512-5p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000431268
Biotype: retained_intron
Gene id: ENSG00000234741
Gene Name: GAS5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-512-5p
Sequence: cacucagccuugagggcacuuuc
MirBase ID: MIMAT0002822
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
HS27a
IP
Tested Cell Line: HS27a
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:173866678-173866706
exon
HITS-CLIP
DIRECT
LncBasev2
1:173866678-173866706
exon
HITS-CLIP
DIRECT
LncBasev2
MALAT1
hsa-miR-512-5p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000534336
Biotype: lincRNA
Gene id: ENSG00000251562
Gene Name: MALAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-512-5p
Sequence: cacucagccuugagggcacuuuc
MirBase ID: MIMAT0002822
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65504478-65504520
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504478-65504520
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504156-65504213
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504545-65504573
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504156-65504213
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505869-65505905
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504545-65504573
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-512-5p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000501122
Biotype: lincRNA
Gene id: ENSG00000245532
Gene Name: NEAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-512-5p
Sequence: cacucagccuugagggcacuuuc
MirBase ID: MIMAT0002822
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65444664-65444692
exon
HITS-CLIP
DIRECT
LncBasev2
11:65428171-65428199
exon
HITS-CLIP
DIRECT
LncBasev2
11:65430001-65430029
exon
HITS-CLIP
DIRECT
LncBasev2
11:65436222-65436250
exon
HITS-CLIP
DIRECT
LncBasev2
11:65445440-65445468
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-473N11.2
hsa-miR-512-5p
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000537175
Biotype: processed_pseudogene
Gene id: ENSG00000256238
Gene Name: RP11-473N11.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-512-5p
Sequence: cacucagccuugagggcacuuuc
MirBase ID: MIMAT0002822
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:16401638-16401666
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-651P23.4
hsa-miR-512-5p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000463122
Biotype: processed_pseudogene
Gene id: ENSG00000224831
Gene Name: RP11-651P23.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-512-5p
Sequence: cacucagccuugagggcacuuuc
MirBase ID: MIMAT0002822
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
HS27a
IP
Tested Cell Line: HS27a
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:149983198-149983226
exon
HITS-CLIP
DIRECT
LncBasev2
3:149983198-149983226
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-793H13.8
hsa-miR-512-5p
IP

Gene Details
Chromosome: 12
Transcript: ENST00000547717
Biotype: retained_intron
Gene id: ENSG00000257379
Gene Name: RP11-793H13.8
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-512-5p
Sequence: cacucagccuugagggcacuuuc
MirBase ID: MIMAT0002822
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:53461084-53461112
exon
HITS-CLIP
DIRECT
LncBasev2
RP4-622L5.2
hsa-miR-512-5p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000515055
Biotype: sense_intronic
Gene id: ENSG00000250135
Gene Name: RP4-622L5.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-512-5p
Sequence: cacucagccuugagggcacuuuc
MirBase ID: MIMAT0002822
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:32176416-32176453
exon
HITS-CLIP
DIRECT
LncBasev2
RPL4P4
hsa-miR-512-5p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000422486
Biotype: processed_pseudogene
Gene id: ENSG00000229638
Gene Name: RPL4P4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-512-5p
Sequence: cacucagccuugagggcacuuuc
MirBase ID: MIMAT0002822
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:185418582-185418610
exon
HITS-CLIP
DIRECT
LncBasev2
RPPH1
hsa-miR-512-5p
IP

Gene Details
Chromosome: 14
Transcript: ENST00000554988
Biotype: antisense
Gene id: ENSG00000259001
Gene Name: RPPH1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-512-5p
Sequence: cacucagccuugagggcacuuuc
MirBase ID: MIMAT0002822
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:20343369-20343397
exon
HITS-CLIP
DIRECT
LncBasev2
SCARNA2
hsa-miR-512-5p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000602755
Biotype: lincRNA
Gene id: ENSG00000270066
Gene Name: SCARNA2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-512-5p
Sequence: cacucagccuugagggcacuuuc
MirBase ID: MIMAT0002822
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:109100248-109100282
exon
HITS-CLIP
DIRECT
LncBasev2
1:109100248-109100282
exon
HITS-CLIP
DIRECT
LncBasev2
SNHG1
hsa-miR-512-5p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000538654
Biotype: retained_intron
Gene id: ENSG00000255717
Gene Name: SNHG1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-512-5p
Sequence: cacucagccuugagggcacuuuc
MirBase ID: MIMAT0002822
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:62855294-62855322
exon
HITS-CLIP
DIRECT
LncBasev2
TTC3P1
hsa-miR-512-5p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000399586
Biotype: processed_pseudogene
Gene id: ENSG00000215105
Gene Name: TTC3P1
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-512-5p
Sequence: cacucagccuugagggcacuuuc
MirBase ID: MIMAT0002822
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
HS27a
IP
Tested Cell Line: HS27a
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:75741672-75741712
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: