Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-519a-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC005154.6
hsa-miR-519a-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000581794
Biotype: retained_intron
Gene id: ENSG00000196295
Gene Name: AC005154.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-519a-3p
Sequence: aaagugcauccuuuuagagugu
MirBase ID: MIMAT0002869
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:30567933-30567961
exon
HITS-CLIP
DIRECT
LncBasev2
AC007036.5
hsa-miR-519a-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000511893
Biotype: sense_overlapping
Gene id: ENSG00000251660
Gene Name: AC007036.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-519a-3p
Sequence: aaagugcauccuuuuagagugu
MirBase ID: MIMAT0002869
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:30159339-30159367
exon
HITS-CLIP
DIRECT
LncBasev2
AL133243.2
hsa-miR-519a-3p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000617415
Biotype: sense_intronic
Gene id: ENSG00000276517
Gene Name: AL133243.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-519a-3p
Sequence: aaagugcauccuuuuagagugu
MirBase ID: MIMAT0002869
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:32527424-32527452
exon
HITS-CLIP
DIRECT
LncBasev2
BAIAP2-AS1
hsa-miR-519a-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000577066
Biotype: lincRNA
Gene id: ENSG00000226137
Gene Name: BAIAP2-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-519a-3p
Sequence: aaagugcauccuuuuagagugu
MirBase ID: MIMAT0002869
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:81031337-81031365
exon
HITS-CLIP
DIRECT
LncBasev2
BZW1P2
hsa-miR-519a-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000473537
Biotype: processed_pseudogene
Gene id: ENSG00000198406
Gene Name: BZW1P2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-519a-3p
Sequence: aaagugcauccuuuuagagugu
MirBase ID: MIMAT0002869
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:116646194-116646222
exon
HITS-CLIP
DIRECT
LncBasev2
CDC42P6
hsa-miR-519a-3p
-
IP

Gene Details
Chromosome: 4
Transcript: ENST00000421246
Biotype: processed_pseudogene
Gene id: ENSG00000237350
Gene Name: CDC42P6
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-519a-3p
Sequence: aaagugcauccuuuuagagugu
MirBase ID: MIMAT0002869
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:22727470-22727498
exon
HITS-CLIP
DIRECT
LncBasev2
CSNK1G2P1
hsa-miR-519a-3p
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000442675
Biotype: processed_pseudogene
Gene id: ENSG00000234534
Gene Name: CSNK1G2P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-519a-3p
Sequence: aaagugcauccuuuuagagugu
MirBase ID: MIMAT0002869
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:5041406-5041434
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-89H12.4
hsa-miR-519a-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000499521
Biotype: retained_intron
Gene id: ENSG00000230551
Gene Name: CTB-89H12.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-519a-3p
Sequence: aaagugcauccuuuuagagugu
MirBase ID: MIMAT0002869
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149494847-149494913
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P11
hsa-miR-519a-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000415278
Biotype: processed_pseudogene
Gene id: ENSG00000228502
Gene Name: EEF1A1P11
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-519a-3p
Sequence: aaagugcauccuuuuagagugu
MirBase ID: MIMAT0002869
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:96447431-96447459
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P19
hsa-miR-519a-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000513637
Biotype: processed_pseudogene
Gene id: ENSG00000249855
Gene Name: EEF1A1P19
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-519a-3p
Sequence: aaagugcauccuuuuagagugu
MirBase ID: MIMAT0002869
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:43495929-43495957
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P9
hsa-miR-519a-3p
-
IP

Gene Details
Chromosome: 4
Transcript: ENST00000514975
Biotype: processed_pseudogene
Gene id: ENSG00000249264
Gene Name: EEF1A1P9
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-519a-3p
Sequence: aaagugcauccuuuuagagugu
MirBase ID: MIMAT0002869
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:105485193-105485221
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1B2P3
hsa-miR-519a-3p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000447718
Biotype: processed_pseudogene
Gene id: ENSG00000232472
Gene Name: EEF1B2P3
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-519a-3p
Sequence: aaagugcauccuuuuagagugu
MirBase ID: MIMAT0002869
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:24788661-24788689
exon
HITS-CLIP
DIRECT
LncBasev2
FLJ37201
hsa-miR-519a-3p
IP

Gene Details
Chromosome: 10
Transcript: ENST00000455699
Biotype: lincRNA
Gene id: ENSG00000240996
Gene Name: FLJ37201
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary

miRNA Details
Name: hsa-miR-519a-3p
Sequence: aaagugcauccuuuuagagugu
MirBase ID: MIMAT0002869
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
10:89694389-89694417
exon
HITS-CLIP
DIRECT
LncBasev2
GABPB1-AS1
hsa-miR-519a-3p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000499624
Biotype: antisense
Gene id: ENSG00000244879
Gene Name: GABPB1-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-519a-3p
Sequence: aaagugcauccuuuuagagugu
MirBase ID: MIMAT0002869
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:50364157-50364185
exon
HITS-CLIP
DIRECT
LncBasev2
INO80B-WBP1
hsa-miR-519a-3p
IP

Gene Details
Chromosome: 2
Transcript: NR_037849.1
Biotype: sense
Gene id: NR_037849.1 (gene)
Gene Name: INO80B-WBP1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-519a-3p
Sequence: aaagugcauccuuuuagagugu
MirBase ID: MIMAT0002869
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:74460347-74460375
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00657
hsa-miR-519a-3p
IP

Gene Details
Chromosome: 20
Transcript: ENST00000565493
Biotype: lincRNA
Gene id: ENSG00000260032
Gene Name: LINC00657
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-519a-3p
Sequence: aaagugcauccuuuuagagugu
MirBase ID: MIMAT0002869
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
20:36048197-36048225
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00674
hsa-miR-519a-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000620266
Biotype: lincRNA
Gene id: ENSG00000278730
Gene Name: LINC00674
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-519a-3p
Sequence: aaagugcauccuuuuagagugu
MirBase ID: MIMAT0002869
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:68129292-68129320
exon
HITS-CLIP
DIRECT
LncBasev2
17:68129574-68129602
exon
HITS-CLIP
DIRECT
LncBasev2
LOC388692
hsa-miR-519a-3p
IP

Gene Details
Chromosome: 1
Transcript: NR_027002.1
Biotype: lincRNA
Gene id: NR_027002.1 (gene)
Gene Name: LOC388692
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-519a-3p
Sequence: aaagugcauccuuuuagagugu
MirBase ID: MIMAT0002869
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:143786987-143787015
exon
HITS-CLIP
DIRECT
LncBasev2
LRRC37A6P
hsa-miR-519a-3p
-
IP

Gene Details
Chromosome: 10
Transcript: ENST00000448648
Biotype: transcribed_processed_pseudogene
Gene id: ENSG00000230445
Gene Name: LRRC37A6P
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-miR-519a-3p
Sequence: aaagugcauccuuuuagagugu
MirBase ID: MIMAT0002869
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
10:27248574-27248602
exon
HITS-CLIP
DIRECT
LncBasev2
MEG3
hsa-miR-519a-3p
IP

Gene Details
Chromosome: 14
Transcript: ENST00000522771
Biotype: lincRNA
Gene id: ENSG00000214548
Gene Name: MEG3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-519a-3p
Sequence: aaagugcauccuuuuagagugu
MirBase ID: MIMAT0002869
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:100847226-100847254
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: