Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-520h

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
CASC7
hsa-miR-520h
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-520h
Sequence: acaaagugcuucccuuuagagu
MirBase ID: MIMAT0002867
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140524213-140524241
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-89H12.4
hsa-miR-520h
IP

Gene Details
Chromosome: 5
Transcript: ENST00000499521
Biotype: retained_intron
Gene id: ENSG00000230551
Gene Name: CTB-89H12.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-520h
Sequence: acaaagugcuucccuuuagagu
MirBase ID: MIMAT0002867
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149494870-149494898
exon
HITS-CLIP
DIRECT
LncBasev2
FAM211A-AS1
hsa-miR-520h
IP

Gene Details
Chromosome: 17
Transcript: NR_027160.1
Biotype: antisense
Gene id: NR_027160.1 (gene)
Gene Name: FAM211A-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-520h
Sequence: acaaagugcuucccuuuagagu
MirBase ID: MIMAT0002867
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:16441814-16441842
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00662
hsa-miR-520h
IP

Gene Details
Chromosome: 19
Transcript: ENST00000561521
Biotype: lincRNA
Gene id: ENSG00000261824
Gene Name: LINC00662
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-520h
Sequence: acaaagugcuucccuuuagagu
MirBase ID: MIMAT0002867
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:27730588-27730616
exon
HITS-CLIP
DIRECT
LncBasev2
LRRC75A-AS1
hsa-miR-520h
IP

Gene Details
Chromosome: 17
Transcript: ENST00000497774
Biotype: retained_intron
Gene id: ENSG00000175061
Gene Name: LRRC75A-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-520h
Sequence: acaaagugcuucccuuuagagu
MirBase ID: MIMAT0002867
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:16441814-16441842
exon
HITS-CLIP
DIRECT
LncBasev2
MALAT1
hsa-miR-520h
IP

Gene Details
Chromosome: 11
Transcript: ENST00000534336
Biotype: lincRNA
Gene id: ENSG00000251562
Gene Name: MALAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-520h
Sequence: acaaagugcuucccuuuagagu
MirBase ID: MIMAT0002867
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65501500-65501528
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501067-65501095
exon
HITS-CLIP
DIRECT
LncBasev2
MYL6P2
hsa-miR-520h
-
IP

Gene Details
Chromosome: 21
Transcript: ENST00000450079
Biotype: processed_pseudogene
Gene id: ENSG00000235808
Gene Name: MYL6P2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-520h
Sequence: acaaagugcuucccuuuagagu
MirBase ID: MIMAT0002867
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
21:39488499-39488527
exon
HITS-CLIP
DIRECT
LncBasev2
RNU12
hsa-miR-520h
IP

Gene Details
Chromosome: 22
Transcript: ENST00000602478
Biotype: lincRNA
Gene id: ENSG00000270022
Gene Name: RNU12
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
HREpiC Kidney Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-520h
Sequence: acaaagugcuucccuuuagagu
MirBase ID: MIMAT0002867
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:42615337-42615365
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-262D11.2
hsa-miR-520h
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000623354
Biotype: processed_transcript
Gene id: ENSG00000225471
Gene Name: RP11-262D11.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-520h
Sequence: acaaagugcuucccuuuagagu
MirBase ID: MIMAT0002867
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:72160342-72160370
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-365O16.1
hsa-miR-520h
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000415453
Biotype: processed_pseudogene
Gene id: ENSG00000236773
Gene Name: RP11-365O16.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-520h
Sequence: acaaagugcuucccuuuagagu
MirBase ID: MIMAT0002867
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:224175531-224175559
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-415J8.5
hsa-miR-520h
IP

Gene Details
Chromosome: 1
Transcript: ENST00000432703
Biotype: antisense
Gene id: ENSG00000233246
Gene Name: RP11-415J8.5
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-520h
Sequence: acaaagugcuucccuuuagagu
MirBase ID: MIMAT0002867
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:33363127-33363155
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-475C16.1
hsa-miR-520h
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000492974
Biotype: processed_pseudogene
Gene id: ENSG00000218426
Gene Name: RP11-475C16.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-520h
Sequence: acaaagugcuucccuuuagagu
MirBase ID: MIMAT0002867
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:153282573-153282601
exon
HITS-CLIP
DIRECT
LncBasev2
RP4-575N6.2
hsa-miR-520h
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000455561
Biotype: processed_pseudogene
Gene id: ENSG00000228399
Gene Name: RP4-575N6.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-520h
Sequence: acaaagugcuucccuuuagagu
MirBase ID: MIMAT0002867
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:101256422-101256450
exon
HITS-CLIP
DIRECT
LncBasev2
YWHAQP6
hsa-miR-520h
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000508556
Biotype: processed_pseudogene
Gene id: ENSG00000249986
Gene Name: YWHAQP6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-520h
Sequence: acaaagugcuucccuuuagagu
MirBase ID: MIMAT0002867
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:141600321-141600349
exon
HITS-CLIP
DIRECT
LncBasev2
ZFAS1
hsa-miR-520h
IP

Gene Details
Chromosome: 20
Transcript: ENST00000450535
Biotype: antisense
Gene id: ENSG00000177410
Gene Name: ZFAS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-520h
Sequence: acaaagugcuucccuuuagagu
MirBase ID: MIMAT0002867
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
20:49289181-49289209
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: