Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-548au-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AL845472.1
hsa-miR-548au-3p
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000624675
Biotype: pseudogene
Gene id: ENSG00000279561
Gene Name: AL845472.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-548au-3p
Sequence: uggcaguuacuuuugcaccag
MirBase ID: MIMAT0022292
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:41271550-41271578
exon
HITS-CLIP
DIRECT
LncBasev2
BLOC1S5-TXNDC5
hsa-miR-548au-3p
IP

Gene Details
Chromosome: 6
Transcript: NR_037616.1
Biotype: sense
Gene id: NR_037616.1 (gene)
Gene Name: BLOC1S5-TXNDC5
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-548au-3p
Sequence: uggcaguuacuuuugcaccag
MirBase ID: MIMAT0022292
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:7891632-7891660
exon
HITS-CLIP
DIRECT
LncBasev2
BZW1P2
hsa-miR-548au-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000473537
Biotype: processed_pseudogene
Gene id: ENSG00000198406
Gene Name: BZW1P2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-548au-3p
Sequence: uggcaguuacuuuugcaccag
MirBase ID: MIMAT0022292
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:116646493-116646521
exon
HITS-CLIP
DIRECT
LncBasev2
CASC7
hsa-miR-548au-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-548au-3p
Sequence: uggcaguuacuuuugcaccag
MirBase ID: MIMAT0022292
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140527602-140527630
exon
HITS-CLIP
DIRECT
LncBasev2
chr22-38_28785274-29006793.1
hsa-miR-548au-3p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-548au-3p
Sequence: uggcaguuacuuuugcaccag
MirBase ID: MIMAT0022292
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:29054163-29054191
exon
HITS-CLIP
DIRECT
LncBasev2
CKMT2-AS1
hsa-miR-548au-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000501927
Biotype: antisense
Gene id: ENSG00000247572
Gene Name: CKMT2-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-548au-3p
Sequence: uggcaguuacuuuugcaccag
MirBase ID: MIMAT0022292
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:81238498-81238526
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-89H12.4
hsa-miR-548au-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000499521
Biotype: retained_intron
Gene id: ENSG00000230551
Gene Name: CTB-89H12.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-548au-3p
Sequence: uggcaguuacuuuugcaccag
MirBase ID: MIMAT0022292
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149494940-149494968
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2366F13.1
hsa-miR-548au-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000499459
Biotype: antisense
Gene id: ENSG00000247796
Gene Name: CTD-2366F13.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-548au-3p
Sequence: uggcaguuacuuuugcaccag
MirBase ID: MIMAT0022292
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:53112949-53112977
exon
HITS-CLIP
DIRECT
LncBasev2
DDX10P1
hsa-miR-548au-3p
-
IP

Gene Details
Chromosome: 10
Transcript: ENST00000448545
Biotype: processed_pseudogene
Gene id: ENSG00000237135
Gene Name: DDX10P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-548au-3p
Sequence: uggcaguuacuuuugcaccag
MirBase ID: MIMAT0022292
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
10:30920932-30920960
exon
HITS-CLIP
DIRECT
LncBasev2
DYNC1I2P1
hsa-miR-548au-3p
-
IP

Gene Details
Chromosome: 10
Transcript: ENST00000435916
Biotype: processed_pseudogene
Gene id: ENSG00000225137
Gene Name: DYNC1I2P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-548au-3p
Sequence: uggcaguuacuuuugcaccag
MirBase ID: MIMAT0022292
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
10:50265668-50265696
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P12
hsa-miR-548au-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000443590
Biotype: processed_pseudogene
Gene id: ENSG00000214199
Gene Name: EEF1A1P12
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-548au-3p
Sequence: uggcaguuacuuuugcaccag
MirBase ID: MIMAT0022292
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:106697519-106697547
exon
HITS-CLIP
DIRECT
LncBasev2
GS1-124K5.11
hsa-miR-548au-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000449307
Biotype: lincRNA
Gene id: ENSG00000229180
Gene Name: GS1-124K5.11
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-548au-3p
Sequence: uggcaguuacuuuugcaccag
MirBase ID: MIMAT0022292
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:66526363-66526391
exon
HITS-CLIP
DIRECT
LncBasev2
HMGA1P8
hsa-miR-548au-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000414130
Biotype: processed_pseudogene
Gene id: ENSG00000233155
Gene Name: HMGA1P8
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-548au-3p
Sequence: uggcaguuacuuuugcaccag
MirBase ID: MIMAT0022292
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:74418232-74418260
exon
HITS-CLIP
DIRECT
LncBasev2
KCNQ1OT1
hsa-miR-548au-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000597346
Biotype: antisense
Gene id: ENSG00000269821
Gene Name: KCNQ1OT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-548au-3p
Sequence: uggcaguuacuuuugcaccag
MirBase ID: MIMAT0022292
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:2644932-2644960
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00888
hsa-miR-548au-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000482098
Biotype: retained_intron
Gene id: ENSG00000240024
Gene Name: LINC00888
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-548au-3p
Sequence: uggcaguuacuuuugcaccag
MirBase ID: MIMAT0022292
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:183453879-183453907
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00923
hsa-miR-548au-3p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000503768
Biotype: lincRNA
Gene id: ENSG00000251209
Gene Name: LINC00923
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-548au-3p
Sequence: uggcaguuacuuuugcaccag
MirBase ID: MIMAT0022292
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:97742970-97742998
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00923
hsa-miR-548au-3p
IP

Gene Details
Chromosome: 15
Transcript: NR_024172.1
Biotype: lincRNA
Gene id: NR_024172.1 (gene)
Gene Name: LINC00923
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-548au-3p
Sequence: uggcaguuacuuuugcaccag
MirBase ID: MIMAT0022292
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:97742970-97742998
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-548au-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000501122
Biotype: lincRNA
Gene id: ENSG00000245532
Gene Name: NEAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-548au-3p
Sequence: uggcaguuacuuuugcaccag
MirBase ID: MIMAT0022292
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65433125-65433153
exon
HITS-CLIP
DIRECT
LncBasev2
11:65442417-65442445
exon
HITS-CLIP
DIRECT
LncBasev2
11:65443724-65443752
exon
HITS-CLIP
DIRECT
LncBasev2
11:65443771-65443799
exon
HITS-CLIP
DIRECT
LncBasev2
11:65429254-65429282
exon
HITS-CLIP
DIRECT
LncBasev2
11:65443568-65443596
exon
HITS-CLIP
DIRECT
LncBasev2
11:65435668-65435696
exon
HITS-CLIP
DIRECT
LncBasev2
PPP1R14BP3
hsa-miR-548au-3p
-
IP

Gene Details
Chromosome: 4
Transcript: ENST00000509033
Biotype: processed_pseudogene
Gene id: ENSG00000179967
Gene Name: PPP1R14BP3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-548au-3p
Sequence: uggcaguuacuuuugcaccag
MirBase ID: MIMAT0022292
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:139115040-139115068
exon
HITS-CLIP
DIRECT
LncBasev2
RAC1P2
hsa-miR-548au-3p
-
IP

Gene Details
Chromosome: 4
Transcript: ENST00000511164
Biotype: processed_pseudogene
Gene id: ENSG00000249936
Gene Name: RAC1P2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-548au-3p
Sequence: uggcaguuacuuuugcaccag
MirBase ID: MIMAT0022292
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:46724282-46724310
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: