Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-582-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC005154.6
hsa-miR-582-5p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000581794
Biotype: retained_intron
Gene id: ENSG00000196295
Gene Name: AC005154.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-582-5p
Sequence: uuacaguuguucaaccaguuacu
MirBase ID: MIMAT0003247
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:30566883-30566911
exon
HITS-CLIP
DIRECT
LncBasev2
AC006129.2
hsa-miR-582-5p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000601116
Biotype: lincRNA
Gene id: ENSG00000268027
Gene Name: AC006129.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-582-5p
Sequence: uuacaguuguucaaccaguuacu
MirBase ID: MIMAT0003247
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:41550208-41550236
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:41550208-41550236
exon
PAR-CLIP
DIRECT
LncBasev2
AC010492.2
hsa-miR-582-5p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000450182
Biotype: processed_pseudogene
Gene id: ENSG00000235081
Gene Name: AC010492.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-582-5p
Sequence: uuacaguuguucaaccaguuacu
MirBase ID: MIMAT0003247
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:54229943-54229971
exon
HITS-CLIP
DIRECT
LncBasev2
AC015691.13
hsa-miR-582-5p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000394793
Biotype: antisense
Gene id: ENSG00000239920
Gene Name: AC015691.13
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-582-5p
Sequence: uuacaguuguucaaccaguuacu
MirBase ID: MIMAT0003247
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:5572549-5572577
exon
HITS-CLIP
DIRECT
LncBasev2
AC084082.3
hsa-miR-582-5p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000517961
Biotype: lincRNA
Gene id: ENSG00000253190
Gene Name: AC084082.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-582-5p
Sequence: uuacaguuguucaaccaguuacu
MirBase ID: MIMAT0003247
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:66113375-66113403
exon
HITS-CLIP
DIRECT
LncBasev2
AC093838.4
hsa-miR-582-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000438378
Biotype: processed_transcript
Gene id: ENSG00000152117
Gene Name: AC093838.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-582-5p
Sequence: uuacaguuguucaaccaguuacu
MirBase ID: MIMAT0003247
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
2:131500557-131500585
exon
HITS-CLIP
DIRECT
LncBasev2
AC116366.6
hsa-miR-582-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000443093
Biotype: antisense
Gene id: ENSG00000234290
Gene Name: AC116366.6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-582-5p
Sequence: uuacaguuguucaaccaguuacu
MirBase ID: MIMAT0003247
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:132471415-132471443
exon
HITS-CLIP
DIRECT
LncBasev2
AF131215.2
hsa-miR-582-5p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000530248
Biotype: sense_intronic
Gene id: ENSG00000255310
Gene Name: AF131215.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-582-5p
Sequence: uuacaguuguucaaccaguuacu
MirBase ID: MIMAT0003247
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
8:11108862-11108890
exon
HITS-CLIP
DIRECT
LncBasev2
BRD7P4
hsa-miR-582-5p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000406170
Biotype: processed_pseudogene
Gene id: ENSG00000218676
Gene Name: BRD7P4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-582-5p
Sequence: uuacaguuguucaaccaguuacu
MirBase ID: MIMAT0003247
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:111430924-111430952
exon
HITS-CLIP
DIRECT
LncBasev2
CASC7
hsa-miR-582-5p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-582-5p
Sequence: uuacaguuguucaaccaguuacu
MirBase ID: MIMAT0003247
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
8:140520270-140520298
exon
HITS-CLIP
DIRECT
LncBasev2
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140520270-140520298
exon
HITS-CLIP
DIRECT
LncBasev2
8:140526182-140526210
exon
HITS-CLIP
DIRECT
LncBasev2
8:140524473-140524501
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140526182-140526210
exon
PAR-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140522217-140522245
exon
HITS-CLIP
DIRECT
LncBasev2
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
8:140520270-140520298
exon
HITS-CLIP
DIRECT
LncBasev2
CEBPZ-AS1
hsa-miR-582-5p
IP

Gene Details
Chromosome: 2
Transcript: NR_037879.1
Biotype: sense
Gene id: NR_037879.1 (gene)
Gene Name: CEBPZ-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-582-5p
Sequence: uuacaguuguucaaccaguuacu
MirBase ID: MIMAT0003247
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:37204652-37204680
exon
HITS-CLIP
DIRECT
LncBasev2
CTA-315H11.2
hsa-miR-582-5p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000619486
Biotype: sense_intronic
Gene id: ENSG00000274080
Gene Name: CTA-315H11.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-582-5p
Sequence: uuacaguuguucaaccaguuacu
MirBase ID: MIMAT0003247
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:73610307-73610335
exon
HITS-CLIP
DIRECT
LncBasev2
CTA-445C9.14
hsa-miR-582-5p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000566814
Biotype: antisense
Gene id: ENSG00000261188
Gene Name: CTA-445C9.14
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-582-5p
Sequence: uuacaguuguucaaccaguuacu
MirBase ID: MIMAT0003247
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
22:26512738-26512766
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-50E14.5
hsa-miR-582-5p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000600255
Biotype: processed_pseudogene
Gene id: ENSG00000269374
Gene Name: CTB-50E14.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-582-5p
Sequence: uuacaguuguucaaccaguuacu
MirBase ID: MIMAT0003247
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:42485423-42485451
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-89H12.4
hsa-miR-582-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000499521
Biotype: retained_intron
Gene id: ENSG00000230551
Gene Name: CTB-89H12.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-582-5p
Sequence: uuacaguuguucaaccaguuacu
MirBase ID: MIMAT0003247
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149494800-149494828
exon
HITS-CLIP
DIRECT
LncBasev2
5:149496653-149496681
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
5:149503640-149503668
exon
HITS-CLIP
DIRECT
LncBasev2
5:149494800-149494828
exon
HITS-CLIP
DIRECT
LncBasev2
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
5:149494800-149494828
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-428G20.3
hsa-miR-582-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000507241
Biotype: lincRNA
Gene id: ENSG00000248175
Gene Name: CTC-428G20.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-582-5p
Sequence: uuacaguuguucaaccaguuacu
MirBase ID: MIMAT0003247
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:115205548-115205576
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2541M15.4
hsa-miR-582-5p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000607697
Biotype: lincRNA
Gene id: ENSG00000271927
Gene Name: CTD-2541M15.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-582-5p
Sequence: uuacaguuguucaaccaguuacu
MirBase ID: MIMAT0003247
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:6647227-6647255
exon
PAR-CLIP
DIRECT
LncBasev2
EIF1P5
hsa-miR-582-5p
-
IP

Gene Details
Chromosome: 17
Transcript: ENST00000585002
Biotype: unprocessed_pseudogene
Gene id: ENSG00000266563
Gene Name: EIF1P5
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-582-5p
Sequence: uuacaguuguucaaccaguuacu
MirBase ID: MIMAT0003247
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
17:21260088-21260116
exon
HITS-CLIP
DIRECT
LncBasev2
FGD5-AS1
hsa-miR-582-5p
IP

Gene Details
Chromosome: 3
Transcript: ENST00000424349
Biotype: antisense
Gene id: ENSG00000225733
Gene Name: FGD5-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-582-5p
Sequence: uuacaguuguucaaccaguuacu
MirBase ID: MIMAT0003247
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
3:14944502-14944530
exon
HITS-CLIP
DIRECT
LncBasev2
FLJ10038
hsa-miR-582-5p
IP

Gene Details
Chromosome: 15
Transcript: NR_026891.1
Biotype: sense
Gene id: NR_026891.1 (gene)
Gene Name: FLJ10038
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-582-5p
Sequence: uuacaguuguucaaccaguuacu
MirBase ID: MIMAT0003247
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
15:50353824-50353852
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: