Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-628-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC138430.4
hsa-miR-628-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000586064
Biotype: retained_intron
Gene id: ENSG00000267629
Gene Name: AC138430.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-628-3p
Sequence: ucuaguaagaguggcagucga
MirBase ID: MIMAT0003297
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
19:19257423-19257451
exon
HITS-CLIP
DIRECT
LncBasev2
AFG3L1P
hsa-miR-628-3p
-
IP

Gene Details
Chromosome: 16
Transcript: ENST00000437774
Biotype: processed_transcript
Gene id: ENSG00000223959
Gene Name: AFG3L1P
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-628-3p
Sequence: ucuaguaagaguggcagucga
MirBase ID: MIMAT0003297
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
16:89996474-89996502
exon
HITS-CLIP
DIRECT
LncBasev2
CCT8P1
hsa-miR-628-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000413611
Biotype: processed_pseudogene
Gene id: ENSG00000226015
Gene Name: CCT8P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-628-3p
Sequence: ucuaguaagaguggcagucga
MirBase ID: MIMAT0003297
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:147203929-147203957
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-152G17.5
hsa-miR-628-3p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000603744
Biotype: processed_pseudogene
Gene id: ENSG00000270764
Gene Name: CTB-152G17.5
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-628-3p
Sequence: ucuaguaagaguggcagucga
MirBase ID: MIMAT0003297
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:105189802-105189830
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-512J12.4
hsa-miR-628-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000588655
Biotype: processed_transcript
Gene id: ENSG00000267188
Gene Name: CTC-512J12.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-628-3p
Sequence: ucuaguaagaguggcagucga
MirBase ID: MIMAT0003297
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:44447520-44447548
exon
PAR-CLIP
DIRECT
LncBasev2
CTC-529I10.1
hsa-miR-628-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000616896
Biotype: antisense
Gene id: ENSG00000275413
Gene Name: CTC-529I10.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-628-3p
Sequence: ucuaguaagaguggcagucga
MirBase ID: MIMAT0003297
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:16023424-16023452
exon
HITS-CLIP
DIRECT
LncBasev2
DNAJC3-AS1
hsa-miR-628-3p
IP

Gene Details
Chromosome: 13
Transcript: ENST00000499499
Biotype: lincRNA
Gene id: ENSG00000247400
Gene Name: DNAJC3-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-628-3p
Sequence: ucuaguaagaguggcagucga
MirBase ID: MIMAT0003297
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
13:95673165-95673193
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1B2P3
hsa-miR-628-3p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000447718
Biotype: processed_pseudogene
Gene id: ENSG00000232472
Gene Name: EEF1B2P3
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-628-3p
Sequence: ucuaguaagaguggcagucga
MirBase ID: MIMAT0003297
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:24788636-24788664
exon
HITS-CLIP
DIRECT
LncBasev2
FAM35DP
hsa-miR-628-3p
-
IP

Gene Details
Chromosome: 10
Transcript: ENST00000323387
Biotype: unprocessed_pseudogene
Gene id: ENSG00000189014
Gene Name: FAM35DP
UCSC graphic:
Expression:
  Cell Line Tissue Category
HepG2 Liver Cancer/Malignant

miRNA Details
Name: hsa-miR-628-3p
Sequence: ucuaguaagaguggcagucga
MirBase ID: MIMAT0003297
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
10:47710235-47710263
exon
HITS-CLIP
DIRECT
LncBasev2
FTLP3
hsa-miR-628-3p
-
IP

Gene Details
Chromosome: 20
Transcript: ENST00000427242
Biotype: processed_pseudogene
Gene id: ENSG00000226608
Gene Name: FTLP3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-628-3p
Sequence: ucuaguaagaguggcagucga
MirBase ID: MIMAT0003297
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
20:4024295-4024323
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
20:4024295-4024323
exon
HITS-CLIP
DIRECT
LncBasev2
HCP5
hsa-miR-628-3p
IP

Gene Details
Chromosome: 6
Transcript: ENST00000414046
Biotype: sense_overlapping
Gene id: ENSG00000206337
Gene Name: HCP5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-628-3p
Sequence: ucuaguaagaguggcagucga
MirBase ID: MIMAT0003297
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:31465502-31465530
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00641
hsa-miR-628-3p
IP

Gene Details
Chromosome: 14
Transcript: ENST00000555379
Biotype: retained_intron
Gene id: ENSG00000258441
Gene Name: LINC00641
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-628-3p
Sequence: ucuaguaagaguggcagucga
MirBase ID: MIMAT0003297
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:21202107-21202135
exon
HITS-CLIP
DIRECT
LncBasev2
14:21202107-21202135
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00894
hsa-miR-628-3p
IP

Gene Details
Chromosome: X
Transcript: ENST00000425602
Biotype: antisense
Gene id: ENSG00000235703
Gene Name: LINC00894
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-628-3p
Sequence: ucuaguaagaguggcagucga
MirBase ID: MIMAT0003297
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
X:149947612-149947640
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00969
hsa-miR-628-3p
IP

Gene Details
Chromosome: 3
Transcript: ENST00000597482
Biotype: lincRNA
Gene id: ENSG00000242086
Gene Name: LINC00969
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-628-3p
Sequence: ucuaguaagaguggcagucga
MirBase ID: MIMAT0003297
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:195696379-195696407
exon
HITS-CLIP
DIRECT
LncBasev2
MIR4461
hsa-miR-628-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000454092
Biotype: processed_pseudogene
Gene id: ENSG00000198868
Gene Name: MIR4461
UCSC graphic:
Expression:
  Cell Line Tissue Category
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-628-3p
Sequence: ucuaguaagaguggcagucga
MirBase ID: MIMAT0003297
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:134928265-134928293
exon
HITS-CLIP
DIRECT
LncBasev2
5:134928295-134928323
exon
HITS-CLIP
DIRECT
LncBasev2
NAMPTL
hsa-miR-628-3p
-
IP

Gene Details
Chromosome: 10
Transcript: ENST00000440465
Biotype: processed_pseudogene
Gene id: ENSG00000229644
Gene Name: NAMPTL
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-628-3p
Sequence: ucuaguaagaguggcagucga
MirBase ID: MIMAT0003297
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
10:36523204-36523232
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-628-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000501122
Biotype: lincRNA
Gene id: ENSG00000245532
Gene Name: NEAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-628-3p
Sequence: ucuaguaagaguggcagucga
MirBase ID: MIMAT0003297
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
11:65424715-65424743
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425948-65425976
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424715-65424743
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424335-65424363
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424335-65424363
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424715-65424743
exon
HITS-CLIP
DIRECT
LncBasev2
11:65431736-65431764
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424335-65424363
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424335-65424363
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65439925-65439953
exon
HITS-CLIP
DIRECT
LncBasev2
11:65431666-65431694
exon
HITS-CLIP
DIRECT
LncBasev2
11:65431736-65431764
exon
HITS-CLIP
DIRECT
LncBasev2
11:65434096-65434124
exon
HITS-CLIP
DIRECT
LncBasev2
11:65436630-65436658
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425948-65425976
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65436630-65436658
exon
HITS-CLIP
DIRECT
LncBasev2
11:65431666-65431694
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424335-65424363
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-628-3p
IP

Gene Details
Chromosome: 11
Transcript: NR_028272.1
Biotype: lincRNA
Gene id: NR_028272.1 (gene)
Gene Name: NEAT1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-628-3p
Sequence: ucuaguaagaguggcagucga
MirBase ID: MIMAT0003297
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65425948-65425976
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65424335-65424363
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:hippuristanol
Location
Region
Method
Result
Validation Type
Source
11:65424715-65424743
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424335-65424363
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424335-65424363
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424715-65424743
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424335-65424363
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424715-65424743
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424335-65424363
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425948-65425976
exon
HITS-CLIP
DIRECT
LncBasev2
OR7E99P
hsa-miR-628-3p
-
IP

Gene Details
Chromosome: 4
Transcript: ENST00000505750
Biotype: unprocessed_pseudogene
Gene id: ENSG00000250710
Gene Name: OR7E99P
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-628-3p
Sequence: ucuaguaagaguggcagucga
MirBase ID: MIMAT0003297
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
4:4156784-4156812
exon
HITS-CLIP
DIRECT
LncBasev2
OTUD6B-AS1
hsa-miR-628-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000524003
Biotype: antisense
Gene id: ENSG00000253738
Gene Name: OTUD6B-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-628-3p
Sequence: ucuaguaagaguggcagucga
MirBase ID: MIMAT0003297
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:91069374-91069402
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: