Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-628-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC004941.5
hsa-miR-628-5p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000427009
Biotype: processed_pseudogene
Gene id: ENSG00000231397
Gene Name: AC004941.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-628-5p
Sequence: augcugacauauuuacuagagg
MirBase ID: MIMAT0004809
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:149322008-149322036
exon
PAR-CLIP
DIRECT
LncBasev2
AC004967.7
hsa-miR-628-5p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000453589
Biotype: unprocessed_pseudogene
Gene id: ENSG00000243554
Gene Name: AC004967.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HREpiC Kidney Normal/Primary

miRNA Details
Name: hsa-miR-628-5p
Sequence: augcugacauauuuacuagagg
MirBase ID: MIMAT0004809
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:97969012-97969040
exon
HITS-CLIP
DIRECT
LncBasev2
AC005682.5
hsa-miR-628-5p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000422542
Biotype: lincRNA
Gene id: ENSG00000228649
Gene Name: AC005682.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-628-5p
Sequence: augcugacauauuuacuagagg
MirBase ID: MIMAT0004809
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:22860561-22860589
exon
HITS-CLIP
DIRECT
LncBasev2
7:22860561-22860589
exon
HITS-CLIP
DIRECT
LncBasev2
AC006947.1
hsa-miR-628-5p
-
IP

Gene Details
Chromosome: 17
Transcript: ENST00000457168
Biotype: sense_intronic
Gene id: ENSG00000229330
Gene Name: AC006947.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-628-5p
Sequence: augcugacauauuuacuagagg
MirBase ID: MIMAT0004809
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
17:66676359-66676387
exon
HITS-CLIP
DIRECT
LncBasev2
AC009948.7
hsa-miR-628-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000437039
Biotype: processed_pseudogene
Gene id: ENSG00000238082
Gene Name: AC009948.7
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-628-5p
Sequence: augcugacauauuuacuagagg
MirBase ID: MIMAT0004809
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:178455364-178455392
exon
HITS-CLIP
DIRECT
LncBasev2
AC017116.11
hsa-miR-628-5p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000445938
Biotype: sense_overlapping
Gene id: ENSG00000239775
Gene Name: AC017116.11
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary

miRNA Details
Name: hsa-miR-628-5p
Sequence: augcugacauauuuacuagagg
MirBase ID: MIMAT0004809
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
7:44065327-44065355
exon
HITS-CLIP
DIRECT
LncBasev2
AC087499.5
hsa-miR-628-5p
-
IP

Gene Details
Chromosome: 17
Transcript: ENST00000452760
Biotype: processed_pseudogene
Gene id: ENSG00000235546
Gene Name: AC087499.5
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-628-5p
Sequence: augcugacauauuuacuagagg
MirBase ID: MIMAT0004809
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:20613641-20613672
exon
HITS-CLIP
DIRECT
LncBasev2
AC092155.1
hsa-miR-628-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000454675
Biotype: processed_pseudogene
Gene id: ENSG00000229503
Gene Name: AC092155.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-628-5p
Sequence: augcugacauauuuacuagagg
MirBase ID: MIMAT0004809
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:62532851-62532879
exon
HITS-CLIP
DIRECT
LncBasev2
AC093323.3
hsa-miR-628-5p
IP

Gene Details
Chromosome: 4
Transcript: ENST00000307533
Biotype: lincRNA
Gene id: ENSG00000170846
Gene Name: AC093323.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-628-5p
Sequence: augcugacauauuuacuagagg
MirBase ID: MIMAT0004809
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
4:6675127-6675155
exon
HITS-CLIP
DIRECT
LncBasev2
AC144530.1
hsa-miR-628-5p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000452862
Biotype: processed_pseudogene
Gene id: ENSG00000234742
Gene Name: AC144530.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-628-5p
Sequence: augcugacauauuuacuagagg
MirBase ID: MIMAT0004809
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:197850391-197850419
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:197850391-197850419
exon
PAR-CLIP
DIRECT
LncBasev2
AFG3L1P
hsa-miR-628-5p
-
IP

Gene Details
Chromosome: 16
Transcript: ENST00000437774
Biotype: processed_transcript
Gene id: ENSG00000223959
Gene Name: AFG3L1P
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-628-5p
Sequence: augcugacauauuuacuagagg
MirBase ID: MIMAT0004809
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HMSC
Category: Stem/Progenitor
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
16:89995800-89995855
exon
HITS-CLIP
DIRECT
LncBasev2
AL133243.2
hsa-miR-628-5p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000617415
Biotype: sense_intronic
Gene id: ENSG00000276517
Gene Name: AL133243.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-628-5p
Sequence: augcugacauauuuacuagagg
MirBase ID: MIMAT0004809
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:32527436-32527464
exon
HITS-CLIP
DIRECT
LncBasev2
AP000347.2
hsa-miR-628-5p
-
IP

Gene Details
Chromosome: 22
Transcript: ENST00000417194
Biotype: processed_transcript
Gene id: ENSG00000272578
Gene Name: AP000347.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-628-5p
Sequence: augcugacauauuuacuagagg
MirBase ID: MIMAT0004809
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:23691807-23691835
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
22:23691357-23691385
exon
HITS-CLIP
DIRECT
LncBasev2
ATP5G2P4
hsa-miR-628-5p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000442175
Biotype: processed_pseudogene
Gene id: ENSG00000228847
Gene Name: ATP5G2P4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-628-5p
Sequence: augcugacauauuuacuagagg
MirBase ID: MIMAT0004809
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRNA.
Location
Region
Method
Result
Validation Type
Source
X:42099049-42099077
exon
HITS-CLIP
DIRECT
LncBasev2
BZW1P2
hsa-miR-628-5p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000473537
Biotype: processed_pseudogene
Gene id: ENSG00000198406
Gene Name: BZW1P2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-628-5p
Sequence: augcugacauauuuacuagagg
MirBase ID: MIMAT0004809
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:116646525-116646553
exon
HITS-CLIP
DIRECT
LncBasev2
C1orf132
hsa-miR-628-5p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000608023
Biotype: lincRNA
Gene id: ENSG00000203709
Gene Name: C1orf132
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-628-5p
Sequence: augcugacauauuuacuagagg
MirBase ID: MIMAT0004809
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
1:207810217-207810245
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:207819079-207819107
exon
HITS-CLIP
DIRECT
LncBasev2
1:207815104-207815132
exon
HITS-CLIP
DIRECT
LncBasev2
CALM2P4
hsa-miR-628-5p
-
IP

Gene Details
Chromosome: 13
Transcript: ENST00000430810
Biotype: processed_pseudogene
Gene id: ENSG00000233662
Gene Name: CALM2P4
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-628-5p
Sequence: augcugacauauuuacuagagg
MirBase ID: MIMAT0004809
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HMSC
Category: Stem/Progenitor
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
13:98641238-98641266
exon
HITS-CLIP
DIRECT
LncBasev2
CASC7
hsa-miR-628-5p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-628-5p
Sequence: augcugacauauuuacuagagg
MirBase ID: MIMAT0004809
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140521222-140521250
exon
PAR-CLIP
DIRECT
LncBasev2
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140524307-140524335
exon
HITS-CLIP
DIRECT
LncBasev2
CEBPZ-AS1
hsa-miR-628-5p
IP

Gene Details
Chromosome: 2
Transcript: NR_037879.1
Biotype: sense
Gene id: NR_037879.1 (gene)
Gene Name: CEBPZ-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-628-5p
Sequence: augcugacauauuuacuagagg
MirBase ID: MIMAT0004809
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:37202932-37202960
exon
HITS-CLIP
DIRECT
LncBasev2
chr22-38_28785274-29006793.1
hsa-miR-628-5p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-628-5p
Sequence: augcugacauauuuacuagagg
MirBase ID: MIMAT0004809
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
22:28984994-28985022
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: