Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-643

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
ALDOAP2
hsa-miR-643
-
IP

Gene Details
Chromosome: 10
Transcript: ENST00000398050
Biotype: processed_pseudogene
Gene id: ENSG00000214297
Gene Name: ALDOAP2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-643
Sequence: acuuguaugcuagcucagguag
MirBase ID: MIMAT0003313
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCLBAC
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
10:125667082-125667110
exon
PAR-CLIP
DIRECT
LncBasev2
RP11-715J22.6
hsa-miR-643
IP

Gene Details
Chromosome: 16
Transcript: ENST00000561847
Biotype: sense_intronic
Gene id: ENSG00000260293
Gene Name: RP11-715J22.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-miR-643
Sequence: acuuguaugcuagcucagguag
MirBase ID: MIMAT0003313
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: EF3DAGO2
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
16:2477819-2477847
exon
PAR-CLIP
DIRECT
LncBasev2
Funded by: