Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-6803-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
CTB-14A14.2
hsa-miR-6803-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000510294
Biotype: processed_pseudogene
Gene id: ENSG00000248560
Gene Name: CTB-14A14.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-6803-3p
Sequence: ucccucgccuucucacccucag
MirBase ID: MIMAT0027507
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCLBACD1
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:181114855-181114883
exon
PAR-CLIP
DIRECT
LncBasev2
XLOC_007569
hsa-miR-6803-3p
IP

Gene Details
Chromosome: chr9
Transcript: TCONS_00016695
Biotype: transcript isomorph
Gene id: XLOC_007569
Gene Name: XLOC_007569
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
- Prostate Normal/Primary

miRNA Details
Name: hsa-miR-6803-3p
Sequence: ucccucgccuucucacccucag
MirBase ID: MIMAT0027507
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCLBACD3
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
chr9:127235861-127235889
exon
PAR-CLIP
DIRECT
LncBasev2
Funded by: