Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-942-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
C5orf56
hsa-miR-942-3p
IP

Gene Details
Chromosome: 5
Transcript: NR_045116.1
Biotype: sense
Gene id: NR_045116.1 (gene)
Gene Name: C5orf56
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-942-3p
Sequence: cacauggccgaaacagagaagu
MirBase ID: MIMAT0026734
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCLBACD3
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:132475968-132475996
exon
PAR-CLIP
DIRECT
LncBasev2
5:132475968-132475996
exon
PAR-CLIP
DIRECT
LncBasev2
5:132475968-132475996
exon
PAR-CLIP
DIRECT
LncBasev2
5:132475968-132475996
exon
PAR-CLIP
DIRECT
LncBasev2
RP1-148H17.1
hsa-miR-942-3p
IP

Gene Details
Chromosome: 20
Transcript: ENST00000437920
Biotype: lincRNA
Gene id: ENSG00000224565
Gene Name: RP1-148H17.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-942-3p
Sequence: cacauggccgaaacagagaagu
MirBase ID: MIMAT0026734
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCLBAC
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
20:47392055-47392083
exon
PAR-CLIP
DIRECT
LncBasev2
SNHG16
hsa-miR-942-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000448136
Biotype: lincRNA
Gene id: ENSG00000163597
Gene Name: SNHG16
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-942-3p
Sequence: cacauggccgaaacagagaagu
MirBase ID: MIMAT0026734
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCLBACD1
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:76564567-76564595
exon
PAR-CLIP
DIRECT
LncBasev2
XLOC_006283
hsa-miR-942-3p
IP

Gene Details
Chromosome: chr7
Transcript: TCONS_00014228
Biotype: transcript isomorph
Gene id: XLOC_006283
Gene Name: XLOC_006283
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary

miRNA Details
Name: hsa-miR-942-3p
Sequence: cacauggccgaaacagagaagu
MirBase ID: MIMAT0026734
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCLBACD1
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
chr7:145158064-145158092
exon
PAR-CLIP
DIRECT
LncBasev2
Funded by: