Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-98-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC091729.9
hsa-miR-98-5p
IP

Gene Details
Chromosome: 7
Transcript: NR_110070.1
Biotype: lincRNA
Gene id: NR_110070.1 (gene)
Gene Name: AC091729.9
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-98-5p
Sequence: ugagguaguaaguuguauuguu
MirBase ID: MIMAT0000096
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:1165347-1165375
exon
PAR-CLIP
DIRECT
LncBasev2
AC091729.9
hsa-miR-98-5p
IP

Gene Details
Chromosome: 7
Transcript: NR_110065.1
Biotype: antisense
Gene id: NR_110065.1 (gene)
Gene Name: AC091729.9
UCSC graphic: -
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-98-5p
Sequence: ugagguaguaaguuguauuguu
MirBase ID: MIMAT0000096
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:1165347-1165375
exon
PAR-CLIP
DIRECT
LncBasev2
AFG3L1P
hsa-miR-98-5p
-
IP

Gene Details
Chromosome: 16
Transcript: ENST00000437774
Biotype: processed_transcript
Gene id: ENSG00000223959
Gene Name: AFG3L1P
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-98-5p
Sequence: ugagguaguaaguuguauuguu
MirBase ID: MIMAT0000096
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
16:89981827-89981855
exon
PAR-CLIP
DIRECT
LncBasev2
CASC7
hsa-miR-98-5p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-98-5p
Sequence: ugagguaguaaguuguauuguu
MirBase ID: MIMAT0000096
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140523483-140523511
exon
PAR-CLIP
DIRECT
LncBasev2
8:140521106-140521134
exon
PAR-CLIP
DIRECT
LncBasev2
8:140522314-140522342
exon
PAR-CLIP
DIRECT
LncBasev2
CTB-119C2.1
hsa-miR-98-5p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000608362
Biotype: antisense
Gene id: ENSG00000273237
Gene Name: CTB-119C2.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-98-5p
Sequence: ugagguaguaaguuguauuguu
MirBase ID: MIMAT0000096
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:26174183-26174211
exon
PAR-CLIP
DIRECT
LncBasev2
CTD-2561J22.2
hsa-miR-98-5p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000594254
Biotype: unprocessed_pseudogene
Gene id: ENSG00000213976
Gene Name: CTD-2561J22.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-98-5p
Sequence: ugagguaguaaguuguauuguu
MirBase ID: MIMAT0000096
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:21386473-21386501
exon
PAR-CLIP
DIRECT
LncBasev2
NUFIP1P
hsa-miR-98-5p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000402902
Biotype: processed_pseudogene
Gene id: ENSG00000218890
Gene Name: NUFIP1P
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-98-5p
Sequence: ugagguaguaaguuguauuguu
MirBase ID: MIMAT0000096
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: EF3DAGO2
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:66094437-66094465
exon
PAR-CLIP
DIRECT
LncBasev2
NUTM2A-AS1
hsa-miR-98-5p
IP

Gene Details
Chromosome: 10
Transcript: ENST00000446751
Biotype: antisense
Gene id: ENSG00000223482
Gene Name: NUTM2A-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-98-5p
Sequence: ugagguaguaaguuguauuguu
MirBase ID: MIMAT0000096
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
10:87245310-87245338
exon
PAR-CLIP
DIRECT
LncBasev2
PITPNA-AS1
hsa-miR-98-5p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000425081
Biotype: antisense
Gene id: ENSG00000236618
Gene Name: PITPNA-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-98-5p
Sequence: ugagguaguaaguuguauuguu
MirBase ID: MIMAT0000096
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:1517865-1517893
exon
PAR-CLIP
DIRECT
LncBasev2
RP11-1103G16.1
hsa-miR-98-5p
IP

Gene Details
Chromosome: 14
Transcript: ENST00000550118
Biotype: antisense
Gene id: ENSG00000257636
Gene Name: RP11-1103G16.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-98-5p
Sequence: ugagguaguaaguuguauuguu
MirBase ID: MIMAT0000096
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:30473534-30473562
exon
PAR-CLIP
DIRECT
LncBasev2
RP11-588K22.2
hsa-miR-98-5p
IP

Gene Details
Chromosome: 4
Transcript: ENST00000569449
Biotype: sense_overlapping
Gene id: ENSG00000260244
Gene Name: RP11-588K22.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-98-5p
Sequence: ugagguaguaaguuguauuguu
MirBase ID: MIMAT0000096
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:155734507-155734535
exon
PAR-CLIP
DIRECT
LncBasev2
RP11-785H5.1
hsa-miR-98-5p
IP

Gene Details
Chromosome: 12
Transcript: ENST00000544420
Biotype: lincRNA
Gene id: ENSG00000256537
Gene Name: RP11-785H5.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-98-5p
Sequence: ugagguaguaaguuguauuguu
MirBase ID: MIMAT0000096
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:11172771-11172799
exon
PAR-CLIP
DIRECT
LncBasev2
RP11-819C21.1
hsa-miR-98-5p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000561746
Biotype: lincRNA
Gene id: ENSG00000261098
Gene Name: RP11-819C21.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-miR-98-5p
Sequence: ugagguaguaaguuguauuguu
MirBase ID: MIMAT0000096
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: EF3DAGO2
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:107314312-107314340
exon
PAR-CLIP
DIRECT
LncBasev2
11:107314312-107314340
exon
PAR-CLIP
DIRECT
LncBasev2
11:107314312-107314340
exon
PAR-CLIP
DIRECT
LncBasev2
11:107314312-107314340
exon
PAR-CLIP
DIRECT
LncBasev2
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:107314312-107314340
exon
PAR-CLIP
DIRECT
LncBasev2
RP11-96D1.10
hsa-miR-98-5p
IP

Gene Details
Chromosome: 16
Transcript: ENST00000571975
Biotype: sense_overlapping
Gene id: ENSG00000263276
Gene Name: RP11-96D1.10
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-98-5p
Sequence: ugagguaguaaguuguauuguu
MirBase ID: MIMAT0000096
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCLBAC
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
16:68227029-68227057
exon
PAR-CLIP
DIRECT
LncBasev2
TRG-AS1
hsa-miR-98-5p
IP

Gene Details
Chromosome: 7
Transcript: NR_040085.1
Biotype: lincRNA
Gene id: NR_040085.1 (gene)
Gene Name: TRG-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-98-5p
Sequence: ugagguaguaaguuguauuguu
MirBase ID: MIMAT0000096
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:38378487-38378515
exon
PAR-CLIP
DIRECT
LncBasev2
7:38378487-38378515
exon
PAR-CLIP
DIRECT
LncBasev2
TTN-AS1
hsa-miR-98-5p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000419746
Biotype: antisense
Gene id: ENSG00000237298
Gene Name: TTN-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-98-5p
Sequence: ugagguaguaaguuguauuguu
MirBase ID: MIMAT0000096
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCLBAC
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:178537648-178537676
exon
PAR-CLIP
DIRECT
LncBasev2
TTTY15
hsa-miR-98-5p
IP

Gene Details
Chromosome: Y
Transcript: ENST00000440408
Biotype: lincRNA
Gene id: ENSG00000233864
Gene Name: TTTY15
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-98-5p
Sequence: ugagguaguaaguuguauuguu
MirBase ID: MIMAT0000096
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
Y:12689368-12689396
exon
PAR-CLIP
DIRECT
LncBasev2
TTTY15
hsa-miR-98-5p
IP

Gene Details
Chromosome: Y
Transcript: NR_001545.2
Biotype: lincRNA
Gene id: NR_001545.2 (gene)
Gene Name: TTTY15
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-98-5p
Sequence: ugagguaguaaguuguauuguu
MirBase ID: MIMAT0000096
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
Y:12689368-12689396
exon
PAR-CLIP
DIRECT
LncBasev2
VTRNA2-1
hsa-miR-98-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000602301
Biotype: lincRNA
Gene id: ENSG00000270123
Gene Name: VTRNA2-1
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-98-5p
Sequence: ugagguaguaaguuguauuguu
MirBase ID: MIMAT0000096
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:136080568-136080596
exon
PAR-CLIP
DIRECT
LncBasev2
XIST
hsa-miR-98-5p
IP

Gene Details
Chromosome: X
Transcript: ENST00000429829
Biotype: lincRNA
Gene id: ENSG00000229807
Gene Name: XIST
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-98-5p
Sequence: ugagguaguaaguuguauuguu
MirBase ID: MIMAT0000096
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCLBACD3
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:73820878-73820906
exon
PAR-CLIP
DIRECT
LncBasev2
X:73843997-73844025
exon
PAR-CLIP
DIRECT
LncBasev2
X:73843997-73844025
exon
PAR-CLIP
DIRECT
LncBasev2
Funded by: