Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-let-7e-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
RP1-178F15.5
hsa-let-7e-5p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000497086
Biotype: processed_transcript
Gene id: ENSG00000271853
Gene Name: RP1-178F15.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: TZMBL
Category: Cancer/Malignant
Experimental Condition: shRNs against HIV-1
Location
Region
Method
Result
Validation Type
Source
1:153627524-153627552
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-78O7.2
hsa-let-7e-5p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000602353
Biotype: lincRNA
Gene id: ENSG00000270091
Gene Name: RP11-78O7.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:19897130-19897158
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-819C21.1
hsa-let-7e-5p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000561746
Biotype: lincRNA
Gene id: ENSG00000261098
Gene Name: RP11-819C21.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: TZMBL
Category: Cancer/Malignant
Experimental Condition: shRNs against HIV-1
Location
Region
Method
Result
Validation Type
Source
11:107314312-107314340
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: LCL35
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:107314312-107314340
exon
PAR-CLIP
DIRECT
LncBasev2
11:107314312-107314340
exon
PAR-CLIP
DIRECT
LncBasev2
11:107314312-107314340
exon
PAR-CLIP
DIRECT
LncBasev2
11:107314312-107314340
exon
PAR-CLIP
DIRECT
LncBasev2
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:107314312-107314340
exon
PAR-CLIP
DIRECT
LncBasev2
Tested Cell Line: HEK293
Category: Embryonic/Fetal
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:107314312-107314340
exon
PAR-CLIP
DIRECT
LncBasev2
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:107314312-107314340
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-822E23.8
hsa-let-7e-5p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000426261
Biotype: processed_transcript
Gene id: ENSG00000272780
Gene Name: RP11-822E23.8
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
17:21534439-21534467
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-824M15.3
hsa-let-7e-5p
-
IP

Gene Details
Chromosome: 18
Transcript: ENST00000592549
Biotype: transcribed_processed_pseudogene
Gene id: ENSG00000267669
Gene Name: RP11-824M15.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRNA.
Location
Region
Method
Result
Validation Type
Source
18:59824281-59824309
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-82H13.2
hsa-let-7e-5p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000441775
Biotype: processed_pseudogene
Gene id: ENSG00000226970
Gene Name: RP11-82H13.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRNA.
Location
Region
Method
Result
Validation Type
Source
1:84244570-84244598
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-834C11.4
hsa-let-7e-5p
IP

Gene Details
Chromosome: 12
Transcript: ENST00000508564
Biotype: lincRNA
Gene id: ENSG00000250742
Gene Name: RP11-834C11.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
12:54132722-54132750
exon
HITS-CLIP
DIRECT
LncBasev2
12:54132722-54132750
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-923I11.8
hsa-let-7e-5p
IP

Gene Details
Chromosome: 12
Transcript: ENST00000618634
Biotype: antisense
Gene id: ENSG00000278451
Gene Name: RP11-923I11.8
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
12:51817954-51817982
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-96D1.10
hsa-let-7e-5p
IP

Gene Details
Chromosome: 16
Transcript: ENST00000571975
Biotype: sense_overlapping
Gene id: ENSG00000263276
Gene Name: RP11-96D1.10
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCLBAC
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
16:68227029-68227057
exon
PAR-CLIP
DIRECT
LncBasev2
RP1-39G22.7
hsa-let-7e-5p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000567508
Biotype: antisense
Gene id: ENSG00000259943
Gene Name: RP1-39G22.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:40257635-40257663
exon
HITS-CLIP
DIRECT
LncBasev2
1:40256734-40256762
exon
HITS-CLIP
DIRECT
LncBasev2
RP3-329A5.8
hsa-let-7e-5p
IP

Gene Details
Chromosome: 6
Transcript: ENST00000605896
Biotype: lincRNA
Gene id: ENSG00000272374
Gene Name: RP3-329A5.8
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:35221000-35221028
exon
HITS-CLIP
DIRECT
LncBasev2
RP3-368A4.5
hsa-let-7e-5p
IP

Gene Details
Chromosome: X
Transcript: ENST00000603037
Biotype: sense_intronic
Gene id: ENSG00000271430
Gene Name: RP3-368A4.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: TZMBL
Category: Cancer/Malignant
Experimental Condition: shRNs against HIV-1
Location
Region
Method
Result
Validation Type
Source
X:74200358-74200386
exon
HITS-CLIP
DIRECT
LncBasev2
RP3-426I6.2
hsa-let-7e-5p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000446554
Biotype: processed_pseudogene
Gene id: ENSG00000231344
Gene Name: RP3-426I6.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:27739347-27739375
exon
HITS-CLIP
DIRECT
LncBasev2
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:27739347-27739375
exon
HITS-CLIP
DIRECT
LncBasev2
RP4-655L22.4
hsa-let-7e-5p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000427955
Biotype: processed_pseudogene
Gene id: ENSG00000181511
Gene Name: RP4-655L22.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: TZMBL
Category: Cancer/Malignant
Experimental Condition: shRNAs against HIV-1
Location
Region
Method
Result
Validation Type
Source
X:120733237-120733265
exon
HITS-CLIP
DIRECT
LncBasev2
RP4-740C4.7
hsa-let-7e-5p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000607858
Biotype: sense_intronic
Gene id: ENSG00000272420
Gene Name: RP4-740C4.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:2363227-2363255
exon
HITS-CLIP
DIRECT
LncBasev2
RPLP0P6
hsa-let-7e-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000394878
Biotype: processed_pseudogene
Gene id: ENSG00000213553
Gene Name: RPLP0P6
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:38482064-38482092
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:38482064-38482092
exon
HITS-CLIP
DIRECT
LncBasev2
RPPH1
hsa-let-7e-5p
IP

Gene Details
Chromosome: 14
Transcript: ENST00000554988
Biotype: antisense
Gene id: ENSG00000259001
Gene Name: RPPH1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HEK293
Category: Embryonic/Fetal
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:20343104-20343132
exon
PAR-CLIP
DIRECT
LncBasev2
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:20343104-20343132
exon
HITS-CLIP
DIRECT
LncBasev2
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:20343104-20343132
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:hippuristanol
Location
Region
Method
Result
Validation Type
Source
14:20343104-20343132
exon
HITS-CLIP
DIRECT
LncBasev2
14:20343104-20343132
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: TZMBL
Category: Cancer/Malignant
Experimental Condition: shRNs against HIV-1
Location
Region
Method
Result
Validation Type
Source
14:20343104-20343132
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: HEK293
Category: Embryonic/Fetal
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:20343104-20343132
exon
PAR-CLIP
DIRECT
LncBasev2
RPS18P12
hsa-let-7e-5p
-
IP

Gene Details
Chromosome: 17
Transcript: ENST00000412454
Biotype: processed_pseudogene
Gene id: ENSG00000230897
Gene Name: RPS18P12
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
17:14705378-14705406
exon
HITS-CLIP
DIRECT
LncBasev2
SBF1P1
hsa-let-7e-5p
-
IP

Gene Details
Chromosome: 8
Transcript: ENST00000444527
Biotype: processed_pseudogene
Gene id: ENSG00000248522
Gene Name: SBF1P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:55450573-55450601
exon
HITS-CLIP
DIRECT
LncBasev2
SCARNA10
hsa-let-7e-5p
IP

Gene Details
Chromosome: 12
Transcript: ENST00000541782
Biotype: sense_intronic
Gene id: ENSG00000276232
Gene Name: SCARNA10
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:6510356-6510384
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: