Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-let-7e-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
LINC01089
hsa-let-7e-5p
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000543334
Biotype: lincRNA
Gene id: ENSG00000212694
Gene Name: LINC01089
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
12:121799527-121799555
exon
HITS-CLIP
DIRECT
LncBasev2
LINC01102
hsa-let-7e-5p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000451400
Biotype: lincRNA
Gene id: ENSG00000235597
Gene Name: LINC01102
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:104506029-104506057
exon
HITS-CLIP
DIRECT
LncBasev2
LINC01277
hsa-let-7e-5p
IP

Gene Details
Chromosome: 6
Transcript: ENST00000419957
Biotype: lincRNA
Gene id: ENSG00000229017
Gene Name: LINC01277
UCSC graphic:
Expression:
  Cell Line Tissue Category
HepG2 Liver Cancer/Malignant

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:143021897-143021925
exon
HITS-CLIP
DIRECT
LncBasev2
LINC01278
hsa-let-7e-5p
IP

Gene Details
Chromosome: X
Transcript: ENST00000608623
Biotype: retained_intron
Gene id: ENSG00000235437
Gene Name: LINC01278
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: TZMBL
Category: Cancer/Malignant
Experimental Condition: shRNs against HIV-1
Location
Region
Method
Result
Validation Type
Source
X:63428082-63428110
exon
HITS-CLIP
DIRECT
LncBasev2
LINC01314
hsa-let-7e-5p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000560778
Biotype: lincRNA
Gene id: ENSG00000259417
Gene Name: LINC01314
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:80200303-80200331
exon
HITS-CLIP
DIRECT
LncBasev2
LOC100506100
hsa-let-7e-5p
IP

Gene Details
Chromosome: 9
Transcript: NR_046240.1
Biotype: antisense
Gene id: NR_046240.1 (gene)
Gene Name: LOC100506100
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:128733013-128733041
exon
HITS-CLIP
DIRECT
LncBasev2
LOC100506124
hsa-let-7e-5p
IP

Gene Details
Chromosome: 2
Transcript: NR_045375.1
Biotype: sense
Gene id: NR_045375.1 (gene)
Gene Name: LOC100506124
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:165871041-165871069
exon
HITS-CLIP
DIRECT
LncBasev2
MALAT1
hsa-let-7e-5p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000534336
Biotype: lincRNA
Gene id: ENSG00000251562
Gene Name: MALAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65502732-65502760
exon
HITS-CLIP
DIRECT
LncBasev2
11:65502732-65502760
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65502732-65502760
exon
HITS-CLIP
DIRECT
LncBasev2
11:65502732-65502760
exon
HITS-CLIP
DIRECT
LncBasev2
11:65502732-65502760
exon
HITS-CLIP
DIRECT
LncBasev2
Mammary Gland
MDAMB231
IP
Tested Cell Line: MDAMB231
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65502732-65502760
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
11:65502732-65502760
exon
HITS-CLIP
DIRECT
LncBasev2
MCM3AP-AS1
hsa-let-7e-5p
IP

Gene Details
Chromosome: 21
Transcript: ENST00000414659
Biotype: antisense
Gene id: ENSG00000215424
Gene Name: MCM3AP-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:hippuristanol
Location
Region
Method
Result
Validation Type
Source
21:46251153-46251181
exon
HITS-CLIP
DIRECT
LncBasev2
21:46251153-46251181
exon
HITS-CLIP
DIRECT
LncBasev2
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
21:46251153-46251181
exon
HITS-CLIP
DIRECT
LncBasev2
MCM3AP-AS1
hsa-let-7e-5p
IP

Gene Details
Chromosome: 21
Transcript: NR_002776.3
Biotype: antisense
Gene id: NR_002776.3 (gene)
Gene Name: MCM3AP-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
21:46251153-46251181
exon
HITS-CLIP
DIRECT
LncBasev2
21:46251153-46251181
exon
HITS-CLIP
DIRECT
LncBasev2
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
21:46251153-46251181
exon
HITS-CLIP
DIRECT
LncBasev2
MEG3
hsa-let-7e-5p
IP

Gene Details
Chromosome: 14
Transcript: ENST00000398461
Biotype: lincRNA
Gene id: ENSG00000214548
Gene Name: MEG3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:100860899-100860927
exon
HITS-CLIP
DIRECT
LncBasev2
MEG3
hsa-let-7e-5p
IP

Gene Details
Chromosome: 14
Transcript: ENST00000398460
Biotype: lincRNA
Gene id: ENSG00000214548
Gene Name: MEG3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:100857337-100857365
exon
HITS-CLIP
DIRECT
LncBasev2
MEG3
hsa-let-7e-5p
IP

Gene Details
Chromosome: 14
Transcript: NR_046467.1
Biotype: lincRNA
Gene id: NR_046467.1 (gene)
Gene Name: MEG3
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:100860899-100860927
exon
HITS-CLIP
DIRECT
LncBasev2
MEG8
hsa-let-7e-5p
IP

Gene Details
Chromosome: 14
Transcript: ENST00000553465
Biotype: lincRNA
Gene id: ENSG00000258399
Gene Name: MEG8
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:100907095-100907123
exon
HITS-CLIP
DIRECT
LncBasev2
MGC16275
hsa-let-7e-5p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000499670
Biotype: antisense
Gene id: ENSG00000246731
Gene Name: MGC16275
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:74210653-74210681
exon
HITS-CLIP
DIRECT
LncBasev2
MIR124-2HG
hsa-let-7e-5p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000521441
Biotype: lincRNA
Gene id: ENSG00000254377
Gene Name: MIR124-2HG
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:64381690-64381718
exon
HITS-CLIP
DIRECT
LncBasev2
MIR3916
hsa-let-7e-5p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000421406
Biotype: transcribed_unprocessed_pseudogene
Gene id: ENSG00000227671
Gene Name: MIR3916
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:247190004-247190032
exon
HITS-CLIP
DIRECT
LncBasev2
1:247190256-247190284
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: TZMBL
Category: Cancer/Malignant
Experimental Condition: shRNAs against HIV-1
Location
Region
Method
Result
Validation Type
Source
1:247190004-247190032
exon
HITS-CLIP
DIRECT
LncBasev2
MIR4453
hsa-let-7e-5p
IP

Gene Details
Chromosome: 4
Transcript: ENST00000604157
Biotype: lincRNA
Gene id: ENSG00000268471
Gene Name: MIR4453
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:152537385-152537413
exon
HITS-CLIP
DIRECT
LncBasev2
MIR99AHG
hsa-let-7e-5p
IP

Gene Details
Chromosome: 21
Transcript: ENST00000619222
Biotype: lincRNA
Gene id: ENSG00000215386
Gene Name: MIR99AHG
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
A549 Lung Cancer/Malignant
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
21:16608303-16608331
exon
HITS-CLIP
DIRECT
LncBasev2
MRPS31P4
hsa-let-7e-5p
-
IP

Gene Details
Chromosome: 13
Transcript: ENST00000509685
Biotype: transcribed_unprocessed_pseudogene
Gene id: ENSG00000250299
Gene Name: MRPS31P4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
13:52617561-52617589
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: