Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-let-7e-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
PXN-AS1
hsa-let-7e-5p
IP

Gene Details
Chromosome: 12
Transcript: ENST00000542314
Biotype: antisense
Gene id: ENSG00000255857
Gene Name: PXN-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
12:120210302-120210330
exon
HITS-CLIP
DIRECT
LncBasev2
RAB4B-EGLN2
hsa-let-7e-5p
IP

Gene Details
Chromosome: 19
Transcript: NR_037791.1
Biotype: sense
Gene id: NR_037791.1 (gene)
Gene Name: RAB4B-EGLN2
UCSC graphic: -
Expression: -

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:40808396-40808424
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
19:40808396-40808424
exon
HITS-CLIP
DIRECT
LncBasev2
RAD51L3-RFFL
hsa-let-7e-5p
IP

Gene Details
Chromosome: 17
Transcript: NR_037714.1
Biotype: sense
Gene id: NR_037714.1 (gene)
Gene Name: RAD51L3-RFFL
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:35010051-35010079
exon
HITS-CLIP
DIRECT
LncBasev2
17:35009767-35009795
exon
HITS-CLIP
DIRECT
LncBasev2
RFPL1S
hsa-let-7e-5p
-
IP

Gene Details
Chromosome: 22
Transcript: ENST00000461286
Biotype: antisense
Gene id: ENSG00000225465
Gene Name: RFPL1S
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:29441474-29441502
exon
HITS-CLIP
DIRECT
LncBasev2
RFPL1S
hsa-let-7e-5p
-
IP

Gene Details
Chromosome: 22
Transcript: NR_002727.2
Biotype: antisense
Gene id: NR_002727.2 (gene)
Gene Name: RFPL1S
UCSC graphic: -
Expression: -

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:29441474-29441502
exon
HITS-CLIP
DIRECT
LncBasev2
RMST
hsa-let-7e-5p
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000547996
Biotype: retained_intron
Gene id: ENSG00000255794
Gene Name: RMST
UCSC graphic:
Expression:
  Cell Line Tissue Category
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:97492777-97492805
exon
HITS-CLIP
DIRECT
LncBasev2
RNASEK-C17orf49
hsa-let-7e-5p
IP

Gene Details
Chromosome: 17
Transcript: NR_037717.1
Biotype: sense
Gene id: NR_037717.1 (gene)
Gene Name: RNASEK-C17orf49
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:7014193-7014221
exon
HITS-CLIP
DIRECT
LncBasev2
RNF216P1
hsa-let-7e-5p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000471244
Biotype: processed_transcript
Gene id: ENSG00000196204
Gene Name: RNF216P1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
7:4998028-4998056
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:4998028-4998056
exon
HITS-CLIP
DIRECT
LncBasev2
RNF219-AS1
hsa-let-7e-5p
IP

Gene Details
Chromosome: 13
Transcript: ENST00000607862
Biotype: antisense
Gene id: ENSG00000234377
Gene Name: RNF219-AS1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
13:78579458-78579486
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-1007O24.2
hsa-let-7e-5p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000568345
Biotype: lincRNA
Gene id: ENSG00000261187
Gene Name: RP11-1007O24.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:72465182-72465210
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-1103G16.1
hsa-let-7e-5p
IP

Gene Details
Chromosome: 14
Transcript: ENST00000550118
Biotype: antisense
Gene id: ENSG00000257636
Gene Name: RP11-1103G16.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:30473534-30473562
exon
PAR-CLIP
DIRECT
LncBasev2
RP11-111M22.4
hsa-let-7e-5p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000606980
Biotype: lincRNA
Gene id: ENSG00000272301
Gene Name: RP11-111M22.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:76389797-76389825
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-121C2.2
hsa-let-7e-5p
IP

Gene Details
Chromosome: 4
Transcript: ENST00000563286
Biotype: lincRNA
Gene id: ENSG00000259959
Gene Name: RP11-121C2.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:47841200-47841228
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-140H17.2
hsa-let-7e-5p
IP

Gene Details
Chromosome: 16
Transcript: ENST00000617574
Biotype: sense_intronic
Gene id: ENSG00000274093
Gene Name: RP11-140H17.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
MDAMB231
IP
Tested Cell Line: MDAMB231
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
16:69632462-69632490
exon
HITS-CLIP
DIRECT
LncBasev2
16:69632462-69632490
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
16:69632462-69632490
exon
HITS-CLIP
DIRECT
LncBasev2
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
16:69632462-69632490
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-164J13.1
hsa-let-7e-5p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000495723
Biotype: processed_transcript
Gene id: ENSG00000258461
Gene Name: RP11-164J13.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:42411826-42411854
exon
HITS-CLIP
DIRECT
LncBasev2
15:42412005-42412033
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-175K6.1
hsa-let-7e-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000523301
Biotype: lincRNA
Gene id: ENSG00000245812
Gene Name: RP11-175K6.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:159107164-159107192
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-196G11.5
hsa-let-7e-5p
IP

Gene Details
Chromosome: 16
Transcript: ENST00000610813
Biotype: sense_intronic
Gene id: ENSG00000278133
Gene Name: RP11-196G11.5
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: TZMBL
Category: Cancer/Malignant
Experimental Condition: shRNs against HIV-1
Location
Region
Method
Result
Validation Type
Source
16:31123889-31123917
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-217B1.2
hsa-let-7e-5p
-
IP

Gene Details
Chromosome: 15
Transcript: ENST00000569473
Biotype: antisense
Gene id: ENSG00000261441
Gene Name: RP11-217B1.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:89335157-89335185
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-227G15.3
hsa-let-7e-5p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000581915
Biotype: processed_transcript
Gene id: ENSG00000265794
Gene Name: RP11-227G15.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:32360666-32360694
exon
HITS-CLIP
DIRECT
LncBasev2
17:32360666-32360694
exon
HITS-CLIP
DIRECT
LncBasev2
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:32360666-32360694
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-228B15.4
hsa-let-7e-5p
IP

Gene Details
Chromosome: 9
Transcript: ENST00000439298
Biotype: antisense
Gene id: ENSG00000225032
Gene Name: RP11-228B15.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
9:127817081-127817109
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: