Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-let-7e-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
RP11-23J9.4
hsa-let-7e-5p
IP

Gene Details
Chromosome: 9
Transcript: ENST00000534123
Biotype: processed_transcript
Gene id: ENSG00000255036
Gene Name: RP11-23J9.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:97314877-97314905
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-263K19.4
hsa-let-7e-5p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000453136
Biotype: antisense
Gene id: ENSG00000231064
Gene Name: RP11-263K19.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:155200259-155200287
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-264B17.3
hsa-let-7e-5p
IP

Gene Details
Chromosome: 16
Transcript: ENST00000569969
Biotype: retained_intron
Gene id: ENSG00000261067
Gene Name: RP11-264B17.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
16:28983254-28983282
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-268P4.4
hsa-let-7e-5p
IP

Gene Details
Chromosome: 12
Transcript: ENST00000542076
Biotype: antisense
Gene id: ENSG00000257023
Gene Name: RP11-268P4.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
12:22624752-22624780
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-293M10.6
hsa-let-7e-5p
IP

Gene Details
Chromosome: 14
Transcript: ENST00000560419
Biotype: antisense
Gene id: ENSG00000259319
Gene Name: RP11-293M10.6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:75427553-75427581
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-29H23.5
hsa-let-7e-5p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000500626
Biotype: unprocessed_pseudogene
Gene id: ENSG00000246203
Gene Name: RP11-29H23.5
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: TZMBL
Category: Cancer/Malignant
Experimental Condition: shRNAs against HIV-1
Location
Region
Method
Result
Validation Type
Source
1:155660113-155660141
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:155660113-155660141
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-321C24.4
hsa-let-7e-5p
-
IP

Gene Details
Chromosome: 13
Transcript: ENST00000622219
Biotype: unprocessed_pseudogene
Gene id: ENSG00000277358
Gene Name: RP11-321C24.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
13:45124038-45124066
exon
HITS-CLIP
DIRECT
LncBasev2
13:45124038-45124066
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-332P22.2
hsa-let-7e-5p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000397646
Biotype: processed_pseudogene
Gene id: ENSG00000214147
Gene Name: RP11-332P22.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
3:190831244-190831272
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-334C17.5
hsa-let-7e-5p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000570309
Biotype: antisense
Gene id: ENSG00000262580
Gene Name: RP11-334C17.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
17:80201080-80201108
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-348J24.2
hsa-let-7e-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000507217
Biotype: lincRNA
Gene id: ENSG00000250049
Gene Name: RP11-348J24.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Heart Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:92415553-92415581
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-357H14.17
hsa-let-7e-5p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000433510
Biotype: lincRNA
Gene id: ENSG00000272763
Gene Name: RP11-357H14.17
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
- Colon Normal/Primary
HREpiC Kidney Normal/Primary
- Kidney Normal/Primary
A549 Lung Cancer/Malignant
- Prostate Normal/Primary
- Testes Normal/Primary
- White Blood Cell Normal/Primary

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
17:48636226-48636254
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-361F15.2
hsa-let-7e-5p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000443556
Biotype: lincRNA
Gene id: ENSG00000225135
Gene Name: RP11-361F15.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:147390103-147390131
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-372K14.2
hsa-let-7e-5p
IP

Gene Details
Chromosome: 4
Transcript: ENST00000603472
Biotype: antisense
Gene id: ENSG00000270681
Gene Name: RP11-372K14.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: TZMBL
Category: Cancer/Malignant
Experimental Condition: shRNs against HIV-1
Location
Region
Method
Result
Validation Type
Source
4:151140768-151140796
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-37B2.1
hsa-let-7e-5p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000504145
Biotype: lincRNA
Gene id: ENSG00000251136
Gene Name: RP11-37B2.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:89724905-89724933
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-389O22.4
hsa-let-7e-5p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000457967
Biotype: processed_pseudogene
Gene id: ENSG00000233839
Gene Name: RP11-389O22.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
1:113169149-113169177
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-391M1.4
hsa-let-7e-5p
IP

Gene Details
Chromosome: 3
Transcript: ENST00000607057
Biotype: lincRNA
Gene id: ENSG00000272452
Gene Name: RP11-391M1.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: TZMBL
Category: Cancer/Malignant
Experimental Condition: shRNs against HIV-1
Location
Region
Method
Result
Validation Type
Source
3:40467675-40467703
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-392E22.3
hsa-let-7e-5p
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000451357
Biotype: processed_pseudogene
Gene id: ENSG00000243085
Gene Name: RP11-392E22.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:38526949-38526977
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-434C1.4
hsa-let-7e-5p
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000614709
Biotype: processed_pseudogene
Gene id: ENSG00000278654
Gene Name: RP11-434C1.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:11500486-11500514
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-438B23.2
hsa-let-7e-5p
IP

Gene Details
Chromosome: 9
Transcript: ENST00000566293
Biotype: sense_overlapping
Gene id: ENSG00000260412
Gene Name: RP11-438B23.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:27938432-27938460
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-439L18.3
hsa-let-7e-5p
IP

Gene Details
Chromosome: 6
Transcript: NR_038987.1
Biotype: lincRNA
Gene id: NR_038987.1 (gene)
Gene Name: RP11-439L18.3
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HepG2 Liver Cancer/Malignant

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:143021897-143021925
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: