Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-let-7e-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
RP11-43F13.1
hsa-let-7e-5p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000507841
Biotype: processed_transcript
Gene id: ENSG00000188002
Gene Name: RP11-43F13.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
5:1599783-1599811
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:1599707-1599735
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-44M6.7
hsa-let-7e-5p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000485071
Biotype: retained_intron
Gene id: ENSG00000274272
Gene Name: RP11-44M6.7
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:100574971-100574999
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-456J20.1
hsa-let-7e-5p
-
IP

Gene Details
Chromosome: 15
Transcript: ENST00000559530
Biotype: processed_pseudogene
Gene id: ENSG00000259358
Gene Name: RP11-456J20.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: TZMBL
Category: Cancer/Malignant
Experimental Condition: shRNAs against HIV-1
Location
Region
Method
Result
Validation Type
Source
15:31767484-31767512
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-462P6.1
hsa-let-7e-5p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000558948
Biotype: lincRNA
Gene id: ENSG00000259447
Gene Name: RP11-462P6.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:39308141-39308169
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-469M7.1
hsa-let-7e-5p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000568571
Biotype: lincRNA
Gene id: ENSG00000260006
Gene Name: RP11-469M7.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
2:200827079-200827107
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: TZMBL
Category: Cancer/Malignant
Experimental Condition: shRNs against HIV-1
Location
Region
Method
Result
Validation Type
Source
2:200827182-200827210
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-488L18.10
hsa-let-7e-5p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000566446
Biotype: lincRNA
Gene id: ENSG00000259865
Gene Name: RP11-488L18.10
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:247188099-247188127
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-491F9.8
hsa-let-7e-5p
IP

Gene Details
Chromosome: 16
Transcript: ENST00000569877
Biotype: lincRNA
Gene id: ENSG00000259957
Gene Name: RP11-491F9.8
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
16:49294972-49295000
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-526D8.11
hsa-let-7e-5p
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000617319
Biotype: unprocessed_pseudogene
Gene id: ENSG00000275318
Gene Name: RP11-526D8.11
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:92841409-92841437
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-545E17.3
hsa-let-7e-5p
IP

Gene Details
Chromosome: 9
Transcript: ENST00000443631
Biotype: antisense
Gene id: ENSG00000223478
Gene Name: RP11-545E17.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:128733013-128733041
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-549J18.1
hsa-let-7e-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000505668
Biotype: sense_intronic
Gene id: ENSG00000251023
Gene Name: RP11-549J18.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:93862255-93862283
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-561N12.5
hsa-let-7e-5p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000409132
Biotype: processed_pseudogene
Gene id: ENSG00000213642
Gene Name: RP11-561N12.5
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:64570056-64570084
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-57H14.4
hsa-let-7e-5p
IP

Gene Details
Chromosome: 10
Transcript: ENST00000564352
Biotype: sense_overlapping
Gene id: ENSG00000260917
Gene Name: RP11-57H14.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
HREpiC Kidney Normal/Primary
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
A549 Lung Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: TZMBL
Category: Cancer/Malignant
Experimental Condition: shRNs against HIV-1
Location
Region
Method
Result
Validation Type
Source
10:112825241-112825277
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-588K22.2
hsa-let-7e-5p
IP

Gene Details
Chromosome: 4
Transcript: ENST00000569449
Biotype: sense_overlapping
Gene id: ENSG00000260244
Gene Name: RP11-588K22.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:155734507-155734535
exon
PAR-CLIP
DIRECT
LncBasev2
RP11-617J18.1
hsa-let-7e-5p
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000551366
Biotype: processed_pseudogene
Gene id: ENSG00000258375
Gene Name: RP11-617J18.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:81545350-81545378
exon
HITS-CLIP
DIRECT
LncBasev2
12:81546024-81546052
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-66B24.4
hsa-let-7e-5p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000560351
Biotype: antisense
Gene id: ENSG00000259583
Gene Name: RP11-66B24.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:100893712-100893740
exon
HITS-CLIP
DIRECT
LncBasev2
15:100893668-100893696
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-745I13.1
hsa-let-7e-5p
-
IP

Gene Details
Chromosome: 11
Transcript: ENST00000532005
Biotype: processed_pseudogene
Gene id: ENSG00000255295
Gene Name: RP11-745I13.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
11:89499007-89499035
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-747H7.3
hsa-let-7e-5p
IP

Gene Details
Chromosome: 14
Transcript: ENST00000565058
Biotype: sense_intronic
Gene id: ENSG00000260711
Gene Name: RP11-747H7.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:91757590-91757618
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-752G15.3
hsa-let-7e-5p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000618020
Biotype: antisense
Gene id: ENSG00000259462
Gene Name: RP11-752G15.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:82651252-82651280
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-75A9.3
hsa-let-7e-5p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000424779
Biotype: processed_pseudogene
Gene id: ENSG00000224072
Gene Name: RP11-75A9.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:46455839-46455867
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-785H5.1
hsa-let-7e-5p
IP

Gene Details
Chromosome: 12
Transcript: ENST00000544420
Biotype: lincRNA
Gene id: ENSG00000256537
Gene Name: RP11-785H5.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:11172771-11172799
exon
PAR-CLIP
DIRECT
LncBasev2
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:11172771-11172799
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: TZMBL
Category: Cancer/Malignant
Experimental Condition: shRNs against HIV-1
Location
Region
Method
Result
Validation Type
Source
12:11172771-11172799
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: