Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-3615

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
MALAT1
hsa-miR-3615
IP

Gene Details
Chromosome: 11
Transcript: ENST00000534336
Biotype: lincRNA
Gene id: ENSG00000251562
Gene Name: MALAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
11:65501524-65501552
exon
HITS-CLIP
DIRECT
LncBasev2
11:65503027-65503055
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505227-65505255
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505878-65505906
exon
HITS-CLIP
DIRECT
LncBasev2
11:65503027-65503055
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505227-65505255
exon
HITS-CLIP
DIRECT
LncBasev2
11:65499333-65499361
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501524-65501552
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505878-65505906
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505227-65505255
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505878-65505906
exon
HITS-CLIP
DIRECT
LncBasev2
11:65503027-65503055
exon
HITS-CLIP
DIRECT
LncBasev2
11:65503027-65503055
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501524-65501552
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505878-65505906
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505227-65505255
exon
HITS-CLIP
DIRECT
LncBasev2
11:65503027-65503055
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501524-65501552
exon
HITS-CLIP
DIRECT
LncBasev2
11:65499333-65499361
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505227-65505255
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505878-65505906
exon
HITS-CLIP
DIRECT
LncBasev2
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65503027-65503055
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505878-65505906
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501524-65501552
exon
HITS-CLIP
DIRECT
LncBasev2
11:65503027-65503055
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505227-65505255
exon
HITS-CLIP
DIRECT
LncBasev2
MAST4-IT1
hsa-miR-3615
IP

Gene Details
Chromosome: 5
Transcript: ENST00000514241
Biotype: sense_intronic
Gene id: ENSG00000249057
Gene Name: MAST4-IT1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
5:66662347-66662375
exon
HITS-CLIP
DIRECT
LncBasev2
MIR3916
hsa-miR-3615
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000421406
Biotype: transcribed_unprocessed_pseudogene
Gene id: ENSG00000227671
Gene Name: MIR3916
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
1:247190310-247190338
exon
HITS-CLIP
DIRECT
LncBasev2
MIR663AHG
hsa-miR-3615
IP

Gene Details
Chromosome: 20
Transcript: ENST00000427348
Biotype: lincRNA
Gene id: ENSG00000227195
Gene Name: MIR663AHG
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
- Lung Normal/Primary
- Testes Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:hippuristanol
Location
Region
Method
Result
Validation Type
Source
20:26209191-26209219
exon
HITS-CLIP
DIRECT
LncBasev2
20:26209191-26209219
exon
HITS-CLIP
DIRECT
LncBasev2
20:26209191-26209219
exon
HITS-CLIP
DIRECT
LncBasev2
20:26209191-26209219
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
20:26209191-26209219
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-3615
IP

Gene Details
Chromosome: 11
Transcript: ENST00000501122
Biotype: lincRNA
Gene id: ENSG00000245532
Gene Name: NEAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
11:65423967-65423995
exon
HITS-CLIP
DIRECT
LncBasev2
11:65422860-65422888
exon
HITS-CLIP
DIRECT
LncBasev2
11:65423222-65423250
exon
HITS-CLIP
DIRECT
LncBasev2
11:65426023-65426051
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424028-65424056
exon
HITS-CLIP
DIRECT
LncBasev2
11:65423967-65423995
exon
HITS-CLIP
DIRECT
LncBasev2
11:65422860-65422888
exon
HITS-CLIP
DIRECT
LncBasev2
11:65444304-65444332
exon
HITS-CLIP
DIRECT
LncBasev2
11:65423222-65423250
exon
HITS-CLIP
DIRECT
LncBasev2
11:65426023-65426051
exon
HITS-CLIP
DIRECT
LncBasev2
11:65423967-65423995
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424028-65424056
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424028-65424056
exon
HITS-CLIP
DIRECT
LncBasev2
11:65426023-65426051
exon
HITS-CLIP
DIRECT
LncBasev2
11:65422860-65422888
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424028-65424056
exon
HITS-CLIP
DIRECT
LncBasev2
11:65422860-65422888
exon
HITS-CLIP
DIRECT
LncBasev2
11:65444304-65444332
exon
HITS-CLIP
DIRECT
LncBasev2
11:65423222-65423250
exon
HITS-CLIP
DIRECT
LncBasev2
11:65426023-65426051
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424028-65424056
exon
HITS-CLIP
DIRECT
LncBasev2
11:65423967-65423995
exon
HITS-CLIP
DIRECT
LncBasev2
11:65426023-65426051
exon
HITS-CLIP
DIRECT
LncBasev2
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65426023-65426051
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-3615
IP

Gene Details
Chromosome: 11
Transcript: NR_028272.1
Biotype: lincRNA
Gene id: NR_028272.1 (gene)
Gene Name: NEAT1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
11:65426023-65426051
exon
HITS-CLIP
DIRECT
LncBasev2
11:65423222-65423250
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424028-65424056
exon
HITS-CLIP
DIRECT
LncBasev2
11:65426023-65426051
exon
HITS-CLIP
DIRECT
LncBasev2
11:65423967-65423995
exon
HITS-CLIP
DIRECT
LncBasev2
11:65423967-65423995
exon
HITS-CLIP
DIRECT
LncBasev2
11:65422860-65422888
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424028-65424056
exon
HITS-CLIP
DIRECT
LncBasev2
11:65422860-65422888
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424028-65424056
exon
HITS-CLIP
DIRECT
LncBasev2
11:65426023-65426051
exon
HITS-CLIP
DIRECT
LncBasev2
11:65426023-65426051
exon
HITS-CLIP
DIRECT
LncBasev2
11:65423222-65423250
exon
HITS-CLIP
DIRECT
LncBasev2
11:65422860-65422888
exon
HITS-CLIP
DIRECT
LncBasev2
11:65423967-65423995
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424028-65424056
exon
HITS-CLIP
DIRECT
LncBasev2
11:65422860-65422888
exon
HITS-CLIP
DIRECT
LncBasev2
11:65423967-65423995
exon
HITS-CLIP
DIRECT
LncBasev2
11:65426023-65426051
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424028-65424056
exon
HITS-CLIP
DIRECT
LncBasev2
11:65423222-65423250
exon
HITS-CLIP
DIRECT
LncBasev2
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65426023-65426051
exon
HITS-CLIP
DIRECT
LncBasev2
OIP5-AS1
hsa-miR-3615
IP

Gene Details
Chromosome: 15
Transcript: ENST00000500949
Biotype: antisense
Gene id: ENSG00000247556
Gene Name: OIP5-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
15:41298928-41298956
exon
HITS-CLIP
DIRECT
LncBasev2
15:41298928-41298956
exon
HITS-CLIP
DIRECT
LncBasev2
OIP5-AS1
hsa-miR-3615
IP

Gene Details
Chromosome: 15
Transcript: NR_026757.1
Biotype: lincRNA
Gene id: NR_026757.1 (gene)
Gene Name: OIP5-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
15:41298928-41298956
exon
HITS-CLIP
DIRECT
LncBasev2
15:41298928-41298956
exon
HITS-CLIP
DIRECT
LncBasev2
PHF2P2
hsa-miR-3615
-
IP

Gene Details
Chromosome: 13
Transcript: ENST00000444553
Biotype: transcribed_unprocessed_pseudogene
Gene id: ENSG00000226057
Gene Name: PHF2P2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
13:18955575-18955603
exon
HITS-CLIP
DIRECT
LncBasev2
PPP1R26-AS1
hsa-miR-3615
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000603893
Biotype: antisense
Gene id: ENSG00000225361
Gene Name: PPP1R26-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
9:135480410-135480438
exon
HITS-CLIP
DIRECT
LncBasev2
PPP1R26-AS1
hsa-miR-3615
IP

Gene Details
Chromosome: 9
Transcript: ENST00000603624
Biotype: antisense
Gene id: ENSG00000225361
Gene Name: PPP1R26-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
9:135468340-135468368
exon
HITS-CLIP
DIRECT
LncBasev2
PVRIG2P
hsa-miR-3615
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000435460
Biotype: transcribed_unprocessed_pseudogene
Gene id: ENSG00000235333
Gene Name: PVRIG2P
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:100353672-100353702
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-113D19.9
hsa-miR-3615
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000618821
Biotype: processed_pseudogene
Gene id: ENSG00000275980
Gene Name: RP11-113D19.9
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
9:21135896-21135924
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-120M18.2
hsa-miR-3615
IP

Gene Details
Chromosome: 17
Transcript: ENST00000590353
Biotype: processed_transcript
Gene id: ENSG00000267009
Gene Name: RP11-120M18.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
HepG2 Liver Cancer/Malignant
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:68515506-68515534
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-156E8.1
hsa-miR-3615
IP

Gene Details
Chromosome: 1
Transcript: ENST00000607453
Biotype: antisense
Gene id: ENSG00000272195
Gene Name: RP11-156E8.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
1:244970682-244970710
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-268P4.6
hsa-miR-3615
IP

Gene Details
Chromosome: 12
Transcript: ENST00000612441
Biotype: sense_intronic
Gene id: ENSG00000274885
Gene Name: RP11-268P4.6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
12:22638755-22638783
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-43N5.1
hsa-miR-3615
IP

Gene Details
Chromosome: 12
Transcript: ENST00000542219
Biotype: lincRNA
Gene id: ENSG00000255970
Gene Name: RP11-43N5.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
12:67709700-67709728
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-626H12.1
hsa-miR-3615
IP

Gene Details
Chromosome: 11
Transcript: ENST00000534086
Biotype: lincRNA
Gene id: ENSG00000255191
Gene Name: RP11-626H12.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
11:69985945-69985973
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-651P23.4
hsa-miR-3615
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000463122
Biotype: processed_pseudogene
Gene id: ENSG00000224831
Gene Name: RP11-651P23.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:149983197-149983225
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-657O9.1
hsa-miR-3615
IP

Gene Details
Chromosome: 3
Transcript: ENST00000459861
Biotype: lincRNA
Gene id: ENSG00000240086
Gene Name: RP11-657O9.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Prostate Normal/Primary

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
3:135374198-135374226
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: