Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-3615

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
U73166.2
hsa-miR-3615
IP

Gene Details
Chromosome: 3
Transcript: ENST00000439898
Biotype: lincRNA
Gene id: ENSG00000230454
Gene Name: U73166.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
3:50261475-50261503
exon
HITS-CLIP
DIRECT
LncBasev2
USP32P1
hsa-miR-3615
-
IP

Gene Details
Chromosome: 17
Transcript: ENST00000393005
Biotype: processed_transcript
Gene id: ENSG00000188933
Gene Name: USP32P1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
17:16803370-16803398
exon
HITS-CLIP
DIRECT
LncBasev2
USP32P2
hsa-miR-3615
-
IP

Gene Details
Chromosome: 17
Transcript: ENST00000412260
Biotype: processed_transcript
Gene id: ENSG00000233327
Gene Name: USP32P2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
17:18512318-18512346
exon
HITS-CLIP
DIRECT
LncBasev2
17:18512318-18512346
exon
HITS-CLIP
DIRECT
LncBasev2
17:18512318-18512346
exon
HITS-CLIP
DIRECT
LncBasev2
XIST
hsa-miR-3615
IP

Gene Details
Chromosome: X
Transcript: ENST00000429829
Biotype: lincRNA
Gene id: ENSG00000229807
Gene Name: XIST
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
X:73823479-73823507
exon
HITS-CLIP
DIRECT
LncBasev2
X:73826397-73826427
exon
HITS-CLIP
DIRECT
LncBasev2
X:73825927-73825955
exon
HITS-CLIP
DIRECT
LncBasev2
X:73823479-73823507
exon
HITS-CLIP
DIRECT
LncBasev2
X:73826397-73826427
exon
HITS-CLIP
DIRECT
LncBasev2
X:73825927-73825955
exon
HITS-CLIP
DIRECT
LncBasev2
X:73825927-73825955
exon
HITS-CLIP
DIRECT
LncBasev2
X:73823479-73823507
exon
HITS-CLIP
DIRECT
LncBasev2
X:73823479-73823507
exon
HITS-CLIP
DIRECT
LncBasev2
XLOC_000019
hsa-miR-3615
IP

Gene Details
Chromosome: chr1
Transcript: TCONS_00000137
Biotype: transcript isomorph
Gene id: XLOC_000019
Gene Name: XLOC_000019
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
chr1:1602397-1602425
exon
HITS-CLIP
DIRECT
LncBasev2
XLOC_002956
hsa-miR-3615
IP

Gene Details
Chromosome: chr3
Transcript: TCONS_00006340
Biotype: transcript isomorph
Gene id: XLOC_002956
Gene Name: XLOC_002956
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Colon Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
Fibroblasts Lung Normal/Primary
- Testes Normal/Primary

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
chr3:185826737-185826765
exon
HITS-CLIP
DIRECT
LncBasev2
XLOC_008005
hsa-miR-3615
IP

Gene Details
Chromosome: chrX
Transcript: TCONS_00017190
Biotype: transcript isomorph
Gene id: XLOC_008005
Gene Name: XLOC_008005
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Heart Normal/Primary

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
chrX:69031023-69031051
exon
HITS-CLIP
DIRECT
LncBasev2
XLOC_010764
hsa-miR-3615
IP

Gene Details
Chromosome: chr14
Transcript: TCONS_00022427
Biotype: transcript isomorph
Gene id: XLOC_010764
Gene Name: XLOC_010764
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Lymph Node Normal/Primary
- Testes Normal/Primary

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
chr14:23509364-23509392
exon
HITS-CLIP
DIRECT
LncBasev2
XLOC_012467
hsa-miR-3615
IP

Gene Details
Chromosome: chr17
Transcript: TCONS_00025630
Biotype: transcript isomorph
Gene id: XLOC_012467
Gene Name: XLOC_012467
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
A549 Lung Cancer/Malignant
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
chr17:40121389-40121417
exon
HITS-CLIP
DIRECT
LncBasev2
XLOC_013981
hsa-miR-3615
IP

Gene Details
Chromosome: chr21
Transcript: TCONS_00028752
Biotype: transcript isomorph
Gene id: XLOC_013981
Gene Name: XLOC_013981
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
chr21:45293159-45293187
exon
HITS-CLIP
DIRECT
LncBasev2
ZNF503-AS2
hsa-miR-3615
IP

Gene Details
Chromosome: 10
Transcript: ENST00000486015
Biotype: antisense
Gene id: ENSG00000237149
Gene Name: ZNF503-AS2
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
10:75402898-75402926
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: