Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-582-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
MTRNR2L2
hsa-miR-582-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000604882
Biotype: processed_pseudogene
Gene id: ENSG00000271043
Gene Name: MTRNR2L2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:80650043-80650071
exon
HITS-CLIP
DIRECT
LncBasev2
MYCLP2
hsa-miR-582-3p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000449268
Biotype: processed_pseudogene
Gene id: ENSG00000228004
Gene Name: MYCLP2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
X:57934104-57934132
exon
HITS-CLIP
DIRECT
LncBasev2
NDUFA9P1
hsa-miR-582-3p
-
IP

Gene Details
Chromosome: 22
Transcript: ENST00000436210
Biotype: processed_pseudogene
Gene id: ENSG00000237406
Gene Name: NDUFA9P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:35897695-35897723
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-582-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000501122
Biotype: lincRNA
Gene id: ENSG00000245532
Gene Name: NEAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
11:65431097-65431125
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65425269-65425297
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425975-65426003
exon
HITS-CLIP
DIRECT
LncBasev2
11:65431097-65431125
exon
HITS-CLIP
DIRECT
LncBasev2
11:65434127-65434155
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
11:65434313-65434341
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425269-65425297
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425975-65426003
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425269-65425297
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425975-65426003
exon
HITS-CLIP
DIRECT
LncBasev2
11:65434127-65434155
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425269-65425297
exon
HITS-CLIP
DIRECT
LncBasev2
11:65434313-65434341
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425269-65425297
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-582-3p
IP

Gene Details
Chromosome: 11
Transcript: NR_028272.1
Biotype: lincRNA
Gene id: NR_028272.1 (gene)
Gene Name: NEAT1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65425975-65426003
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425269-65425297
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:hippuristanol
Location
Region
Method
Result
Validation Type
Source
11:65425269-65425297
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425269-65425297
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425975-65426003
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425269-65425297
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425269-65425297
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425975-65426003
exon
HITS-CLIP
DIRECT
LncBasev2
OIP5-AS1
hsa-miR-582-3p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000500949
Biotype: antisense
Gene id: ENSG00000247556
Gene Name: OIP5-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:41298412-41298440
exon
HITS-CLIP
DIRECT
LncBasev2
OIP5-AS1
hsa-miR-582-3p
IP

Gene Details
Chromosome: 15
Transcript: NR_026757.1
Biotype: lincRNA
Gene id: NR_026757.1 (gene)
Gene Name: OIP5-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:41298412-41298440
exon
HITS-CLIP
DIRECT
LncBasev2
POM121B
hsa-miR-582-3p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000380760
Biotype: unprocessed_pseudogene
Gene id: ENSG00000205578
Gene Name: POM121B
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
7:73294243-73294271
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-1042B17.1
hsa-miR-582-3p
-
IP

Gene Details
Chromosome: 14
Transcript: ENST00000492636
Biotype: processed_pseudogene
Gene id: ENSG00000244756
Gene Name: RP11-1042B17.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
14:60572031-60572059
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-1217F2.1
hsa-miR-582-3p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000433031
Biotype: unprocessed_pseudogene
Gene id: ENSG00000235095
Gene Name: RP11-1217F2.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:57149132-57149160
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-145M9.4
hsa-miR-582-3p
IP

Gene Details
Chromosome: 3
Transcript: ENST00000595265
Biotype: lincRNA
Gene id: ENSG00000269728
Gene Name: RP11-145M9.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
3:179396659-179396687
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-197N18.2
hsa-miR-582-3p
IP

Gene Details
Chromosome: 12
Transcript: ENST00000540866
Biotype: retained_intron
Gene id: ENSG00000256028
Gene Name: RP11-197N18.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
12:122981630-122981658
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-291L22.7
hsa-miR-582-3p
-
IP

Gene Details
Chromosome: 10
Transcript: ENST00000572446
Biotype: processed_pseudogene
Gene id: ENSG00000263064
Gene Name: RP11-291L22.7
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
10:38448682-38448710
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-382J12.1
hsa-miR-582-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000499227
Biotype: antisense
Gene id: ENSG00000246366
Gene Name: RP11-382J12.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
8:70660408-70660436
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-407B7.1
hsa-miR-582-3p
IP

Gene Details
Chromosome: 3
Transcript: ENST00000432154
Biotype: lincRNA
Gene id: ENSG00000230102
Gene Name: RP11-407B7.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
3:194054644-194054672
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-408P14.1
hsa-miR-582-3p
-
IP

Gene Details
Chromosome: 4
Transcript: ENST00000466377
Biotype: processed_pseudogene
Gene id: ENSG00000243199
Gene Name: RP11-408P14.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:65573719-65573747
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-434O22.1
hsa-miR-582-3p
-
IP

Gene Details
Chromosome: 14
Transcript: ENST00000495231
Biotype: processed_pseudogene
Gene id: ENSG00000243824
Gene Name: RP11-434O22.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
14:34740337-34740365
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-438L7.3
hsa-miR-582-3p
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000540341
Biotype: processed_pseudogene
Gene id: ENSG00000255967
Gene Name: RP11-438L7.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:8634492-8634520
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-480N24.3
hsa-miR-582-3p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000406185
Biotype: processed_pseudogene
Gene id: ENSG00000219222
Gene Name: RP11-480N24.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:43310328-43310356
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-575F12.3
hsa-miR-582-3p
IP

Gene Details
Chromosome: 12
Transcript: ENST00000617117
Biotype: lincRNA
Gene id: ENSG00000278266
Gene Name: RP11-575F12.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:127147594-127147622
exon
PAR-CLIP
DIRECT
LncBasev2
Funded by: