Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-582-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
RP11-587D21.1
hsa-miR-582-3p
-
IP

Gene Details
Chromosome: 11
Transcript: ENST00000476147
Biotype: processed_pseudogene
Gene id: ENSG00000240036
Gene Name: RP11-587D21.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:27581718-27581746
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-71L14.4
hsa-miR-582-3p
IP

Gene Details
Chromosome: 16
Transcript: ENST00000619354
Biotype: lincRNA
Gene id: ENSG00000274698
Gene Name: RP11-71L14.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
16:68450360-68450388
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-727A23.5
hsa-miR-582-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000624533
Biotype: TEC
Gene id: ENSG00000247137
Gene Name: RP11-727A23.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:83192290-83192318
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-771F20.1
hsa-miR-582-3p
-
IP

Gene Details
Chromosome: 8
Transcript: ENST00000481577
Biotype: processed_pseudogene
Gene id: ENSG00000239344
Gene Name: RP11-771F20.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:103768544-103768572
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-819C21.1
hsa-miR-582-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000561746
Biotype: lincRNA
Gene id: ENSG00000261098
Gene Name: RP11-819C21.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:107315529-107315557
exon
HITS-CLIP
DIRECT
LncBasev2
RP1-239B22.5
hsa-miR-582-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000568280
Biotype: antisense
Gene id: ENSG00000260196
Gene Name: RP1-239B22.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant

miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
11:17380919-17380947
exon
HITS-CLIP
DIRECT
LncBasev2
RP1-5O6.5
hsa-miR-582-3p
-
IP

Gene Details
Chromosome: 22
Transcript: ENST00000420172
Biotype: antisense
Gene id: ENSG00000235246
Gene Name: RP1-5O6.5
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
22:38231338-38231366
exon
HITS-CLIP
DIRECT
LncBasev2
RP5-1014D13.2
hsa-miR-582-3p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623726
Biotype: sense_overlapping
Gene id: ENSG00000279738
Gene Name: RP5-1014D13.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:37888545-37888581
exon
HITS-CLIP
DIRECT
LncBasev2
RPL15P3
hsa-miR-582-3p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000391491
Biotype: processed_pseudogene
Gene id: ENSG00000212802
Gene Name: RPL15P3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:12514307-12514335
exon
HITS-CLIP
DIRECT
LncBasev2
RPL24P4
hsa-miR-582-3p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000326586
Biotype: processed_pseudogene
Gene id: ENSG00000181524
Gene Name: RPL24P4
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCLBACD3
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:42956636-42956664
exon
PAR-CLIP
DIRECT
LncBasev2
RPL37P2
hsa-miR-582-3p
-
IP

Gene Details
Chromosome: 11
Transcript: ENST00000472498
Biotype: processed_pseudogene
Gene id: ENSG00000239559
Gene Name: RPL37P2
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:67682772-67682800
exon
HITS-CLIP
DIRECT
LncBasev2
SCARNA10
hsa-miR-582-3p
IP

Gene Details
Chromosome: 12
Transcript: ENST00000541782
Biotype: sense_intronic
Gene id: ENSG00000276232
Gene Name: SCARNA10
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:6510383-6510411
exon
HITS-CLIP
DIRECT
LncBasev2
SNHG15
hsa-miR-582-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000577700
Biotype: lincRNA
Gene id: ENSG00000232956
Gene Name: SNHG15
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:44983191-44983219
exon
HITS-CLIP
DIRECT
LncBasev2
SNHG17
hsa-miR-582-3p
IP

Gene Details
Chromosome: 20
Transcript: ENST00000449469
Biotype: retained_intron
Gene id: ENSG00000196756
Gene Name: SNHG17
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
20:38428144-38428172
exon
HITS-CLIP
DIRECT
LncBasev2
ST13P15
hsa-miR-582-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000460666
Biotype: processed_pseudogene
Gene id: ENSG00000243759
Gene Name: ST13P15
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:143517467-143517495
exon
HITS-CLIP
DIRECT
LncBasev2
ST13P3
hsa-miR-582-3p
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000546640
Biotype: processed_pseudogene
Gene id: ENSG00000257773
Gene Name: ST13P3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:106016631-106016659
exon
HITS-CLIP
DIRECT
LncBasev2
TCEA1P2
hsa-miR-582-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000420496
Biotype: processed_pseudogene
Gene id: ENSG00000230409
Gene Name: TCEA1P2
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:37276520-37276548
exon
HITS-CLIP
DIRECT
LncBasev2
TLK1P1
hsa-miR-582-3p
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000456760
Biotype: processed_pseudogene
Gene id: ENSG00000226783
Gene Name: TLK1P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:122686593-122686621
exon
HITS-CLIP
DIRECT
LncBasev2
TLK2P1
hsa-miR-582-3p
-
IP

Gene Details
Chromosome: 17
Transcript: ENST00000530992
Biotype: processed_pseudogene
Gene id: ENSG00000226049
Gene Name: TLK2P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:34038455-34038483
exon
HITS-CLIP
DIRECT
LncBasev2
TRG-AS1
hsa-miR-582-3p
IP

Gene Details
Chromosome: 7
Transcript: NR_040085.1
Biotype: lincRNA
Gene id: NR_040085.1 (gene)
Gene Name: TRG-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:38375986-38376014
exon
PAR-CLIP
DIRECT
LncBasev2
Funded by: