Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-let-7b-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
chr22-38_28785274-29006793.1
hsa-let-7b-3p
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
251502-251521
0.008
1
7mer
124817-124834
0.007
8
7mer
22325-22337
0.007
7
7mer
187414-187423
0.006
2
8mer
100980-100993
0.006
2
8mer
203262-203284
0.005
Not Conserved
8mer
201173-201179
0.005
1
7mer
183274-183289
0.005
2
7mer
20200-20223
0.005
2
7mer
91449-91463
0.005
1
6mer
126983-126999
0.004
13
7mer
40798-40810
0.004
Not Conserved
7mer
24399-24421
0.004
2
7mer
49209-49236
0.004
1
7mer
25312-25334
0.004
1
8mer
83574-83596
0.004
1
6mer
216474-216492
0.004
9
8mer
69594-69608
0.004
3
7mer
197948-197970
0.004
2
7mer
20711-20726
0.004
7
7mer
191874-191884
0.003
2
7mer
87371-87388
0.003
2
7mer
3057-3069
0.003
Not Conserved
7mer
171398-171422
0.003
1
7mer
127003-127015
0.003
15
7mer
105033-105059
0.003
2
8mer
57461-57467
0.003
2
7mer
200617-200642
0.003
2
7mer
185684-185701
0.003
1
6mer
198957-198978
0.003
2
7mer
4036-4052
0.003
Not Conserved
7mer
204423-204428
0.003
2
7mer
106590-106605
0.003
Not Conserved
6mer
88380-88393
0.002
3
6mer
64519-64543
0.002
2
7mer
148620-148625
0.002
2
7mer
161157-161173
0.002
2
7mer
146761-146776
0.002
1
6mer
137035-137039
0.002
1
6mer
92772-92776
0.002
2
6mer
54325-54329
0.002
1
6mer
110930-110955
0.002
1
6mer
104055-104079
0.002
1
6mer
163800-163815
0.002
5
6mer
23824-23828
0.002
1
6mer
158152-158179
0.002
2
6mer
150841-150859
0.002
1
6mer
82786-82802
0.002
1
6mer
170191-170217
0.002
1
6mer
169028-169032
0.002
1
6mer
46881-46905
0.002
2
6mer
80365-80369
0.002
1
6mer
51451-51474
0.002
2
6mer
63846-63860
0.002
2
6mer
111994-111998
0.002
1
6mer
57370-57396
0.002
2
6mer
85034-85046
0.002
2
6mer
126983-127008
0.002
11
6mer
190736-190763
0.002
2
6mer
201388-201403
0.001
Not Conserved
6mer
139647-139663
0.001
1
6mer
97460-97478
0.001
2
6mer
248487-248508
0.001
Not Conserved
6mer
8541-8554
0.001
1
6mer
90437-90452
0.001
2
6mer
104363-104389
0.001
2
6mer
7727-7740
0.001
3
6mer
8667-8687
0.001
3
6mer
162082-162105
0.001
2
6mer
201421-201425
0.001
Not Conserved
6mer
201555-201559
0.001
Not Conserved
6mer
201547-201551
0.001
Not Conserved
6mer
201453-201457
0.001
Not Conserved
6mer
201567-201571
0.001
Not Conserved
6mer
201509-201513
0.001
Not Conserved
6mer
201517-201521
0.001
Not Conserved
6mer
201527-201531
0.001
Not Conserved
6mer
201429-201433
0.001
Not Conserved
6mer
201467-201471
0.001
Not Conserved
6mer
201489-201493
0.001
Not Conserved
RP11-46H11.3
hsa-let-7b-3p
0.999

Gene Details
Chromosome: 12
Transcript: ENST00000503695
Biotype: lincRNA
Gene id: ENSG00000250790
Gene Name: RP11-46H11.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
75-80
0.054
1
7mer
657-662
0.036
1
7mer
2438-2462
0.022
1
6mer
1420-1437
0.005
1
CTC-459F4.3
hsa-let-7b-3p
0.997

Gene Details
Chromosome: 19
Transcript: ENST00000621046
Biotype: sense_intronic
Gene id: ENSG00000267575
Gene Name: CTC-459F4.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
550-564
0.060
1
6mer
530-548
0.025
1
6mer
459-484
0.019
1
RP11-680F20.10
hsa-let-7b-3p
0.995

Gene Details
Chromosome: 11
Transcript: ENST00000564354
Biotype: lincRNA
Gene id: ENSG00000260209
Gene Name: RP11-680F20.10
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
570-595
0.075
1
7mer
57-74
0.022
1
XLOC_002712
hsa-let-7b-3p
0.994

Gene Details
Chromosome: chr3
Transcript: TCONS_00006100
Biotype: transcript isomorph
Gene id: XLOC_002712
Gene Name: XLOC_002712
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Prostate Normal/Primary
- Thyroid Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
333-358
0.096
1
XLOC_005906
hsa-let-7b-3p
0.991

Gene Details
Chromosome: chr6
Transcript: TCONS_00011606
Biotype: transcript isomorph
Gene id: XLOC_005906
Gene Name: XLOC_005906
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
182-195
0.088
1
KCNQ1OT1
hsa-let-7b-3p
0.990

Gene Details
Chromosome: 11
Transcript: ENST00000597346
Biotype: antisense
Gene id: ENSG00000269821
Gene Name: KCNQ1OT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
67800-67819
0.006
2
7mer
63253-63278
0.005
1
7mer
51232-51245
0.004
2
7mer
27782-27800
0.004
1
7mer
16722-16745
0.004
2
7mer
18102-18107
0.003
2
7mer
40121-40139
0.003
1
7mer
25633-25649
0.003
1
6mer
43403-43417
0.003
2
6mer
34631-34651
0.003
1
6mer
7805-7809
0.003
2
6mer
45682-45701
0.003
5
6mer
61314-61318
0.002
2
6mer
52610-52627
0.002
2
6mer
17936-17940
0.002
2
6mer
70568-70572
0.002
2
6mer
21768-21772
0.002
2
6mer
49133-49149
0.002
2
6mer
67959-67973
0.002
2
6mer
32394-32398
0.002
1
6mer
44528-44532
0.002
2
6mer
51981-51997
0.002
2
6mer
71194-71215
0.002
2
6mer
25912-25922
0.002
1
6mer
11025-11037
0.002
2
6mer
86343-86366
0.002
2
6mer
19008-19028
0.002
1
7mer
25446-25465
0.002
1
6mer
14135-14139
0.002
1
7mer
84284-84303
0.001
2
6mer
51154-51177
0.001
2
6mer
24463-24481
0.001
1
6mer
75462-75477
0.001
1
8mer+mismatch
80440-80467
0.001
1
7mer
25534-25554
0.001
1
6mer
85413-85434
0.001
1
6mer
25556-25571
0.001
1
6mer
72952-72975
0.001
Not Conserved
XLOC_001711
hsa-let-7b-3p
0.988

Gene Details
Chromosome: chr2
Transcript: TCONS_00003906
Biotype: transcript isomorph
Gene id: XLOC_001711
Gene Name: XLOC_001711
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
35-55
0.083
2
XLOC_012598
hsa-let-7b-3p
0.988

Gene Details
Chromosome: chr18
Transcript: TCONS_00026224
Biotype: transcript isomorph
Gene id: XLOC_012598
Gene Name: XLOC_012598
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1506-1525
0.045
1
6mer
1793-1797
0.026
1
7mer
1298-1310
0.009
1
6mer
1254-1258
0.003
Not Conserved
CTBP1-AS2
hsa-let-7b-3p
0.987

Gene Details
Chromosome: 4
Transcript: ENST00000505364
Biotype: antisense
Gene id: ENSG00000196810
Gene Name: CTBP1-AS2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
24-29
0.082
2
RP11-680F20.10
hsa-let-7b-3p
0.986

Gene Details
Chromosome: 11
Transcript: ENST00000569238
Biotype: lincRNA
Gene id: ENSG00000260209
Gene Name: RP11-680F20.10
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
152-177
0.081
1
XLOC_006459
hsa-let-7b-3p
0.981

Gene Details
Chromosome: chr7
Transcript: TCONS_00014308
Biotype: transcript isomorph
Gene id: XLOC_006459
Gene Name: XLOC_006459
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
163-179
0.075
2
XLOC_007322
hsa-let-7b-3p
0.975

Gene Details
Chromosome: chr9
Transcript: TCONS_00015659
Biotype: transcript isomorph
Gene id: XLOC_007322
Gene Name: XLOC_007322
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
340-346
0.057
1
7mer
188-210
0.014
Not Conserved
LINC00475
hsa-let-7b-3p
0.969

Gene Details
Chromosome: 9
Transcript: ENST00000421234
Biotype: lincRNA
Gene id: ENSG00000225511
Gene Name: LINC00475
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
- Lung Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Prostate Normal/Primary


miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
417-430
0.067
1
RP11-104J23.1
hsa-let-7b-3p
0.964

Gene Details
Chromosome: 17
Transcript: ENST00000617328
Biotype: antisense
Gene id: ENSG00000275944
Gene Name: RP11-104J23.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1665-1687
0.064
2
AC114776.3
hsa-let-7b-3p
0.964

Gene Details
Chromosome: 2
Transcript: ENST00000414159
Biotype: lincRNA
Gene id: ENSG00000235881
Gene Name: AC114776.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
4267-4286
0.032
2
7mer
4275-4286
0.019
1
7mer
4110-4115
0.013
1
RP1-5O6.4
hsa-let-7b-3p
0.964

Gene Details
Chromosome: 22
Transcript: ENST00000454123
Biotype: sense_intronic
Gene id: ENSG00000229955
Gene Name: RP1-5O6.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
90-109
0.038
1
7mer
62-83
0.027
1
TTTY15
hsa-let-7b-3p
0.962

Gene Details
Chromosome: Y
Transcript: NR_001545.2
Biotype: lincRNA
Gene id: NR_001545.2 (gene)
Gene Name: TTTY15
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
605-612
0.040
1
6mer
1181-1185
0.013
1
7mer
3431-3443
0.010
1
LINC01140
hsa-let-7b-3p
0.958

Gene Details
Chromosome: 1
Transcript: ENST00000461990
Biotype: lincRNA
Gene id: ENSG00000267272
Gene Name: LINC01140
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
3128-3151
0.059
12
6mer
995-1007
0.003
4
XLOC_008295
hsa-let-7b-3p
0.958

Gene Details
Chromosome: chrY
Transcript: TCONS_00017578
Biotype: transcript isomorph
Gene id: XLOC_008295
Gene Name: XLOC_008295
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
HUVEC Blood Vessel Normal/Primary
- Brain Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
A549 Lung Cancer/Malignant
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
638-645
0.039
1
6mer
1214-1218
0.013
1
7mer
3464-3476
0.010
1
Funded by: