Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-187-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
XLOC_000782
hsa-miR-187-3p
1.000

Gene Details
Chromosome: chr1
Transcript: TCONS_00001452
Biotype: transcript isomorph
Gene id: XLOC_000782
Gene Name: XLOC_000782
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Kidney Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
176-192
0.192
1
RP11-474D1.1
hsa-miR-187-3p
0.999

Gene Details
Chromosome: 12
Transcript: ENST00000536512
Biotype: lincRNA
Gene id: ENSG00000256298
Gene Name: RP11-474D1.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
92-106
0.128
2
XLOC_013064
hsa-miR-187-3p
0.999

Gene Details
Chromosome: chr19
Transcript: TCONS_00027536
Biotype: transcript isomorph
Gene id: XLOC_013064
Gene Name: XLOC_013064
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
Fibroblasts Lung Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1239-1261
0.111
2
6mer
2471-2495
0.006
1
RP11-356I2.4
hsa-miR-187-3p
0.977

Gene Details
Chromosome: 6
Transcript: ENST00000606998
Biotype: antisense
Gene id: ENSG00000237499
Gene Name: RP11-356I2.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
- Breast Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1598-1617
0.072
1
PTOV1-AS1
hsa-miR-187-3p
0.972

Gene Details
Chromosome: 19
Transcript: NR_040037.1
Biotype: antisense
Gene id: NR_040037.1 (gene)
Gene Name: PTOV1-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
48-73
0.069
5
PTOV1-AS1
hsa-miR-187-3p
0.972

Gene Details
Chromosome: 19
Transcript: ENST00000596521
Biotype: antisense
Gene id: ENSG00000268006
Gene Name: PTOV1-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant


miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
54-79
0.069
5
XLOC_006187
hsa-miR-187-3p
0.967

Gene Details
Chromosome: chr7
Transcript: TCONS_00013551
Biotype: transcript isomorph
Gene id: XLOC_006187
Gene Name: XLOC_006187
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
106-126
0.066
2
RP11-379F4.4
hsa-miR-187-3p
0.967

Gene Details
Chromosome: 3
Transcript: ENST00000607426
Biotype: antisense
Gene id: ENSG00000240207
Gene Name: RP11-379F4.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1754-1772
0.066
Not Conserved
AC006019.3
hsa-miR-187-3p
0.961

Gene Details
Chromosome: 7
Transcript: ENST00000425591
Biotype: antisense
Gene id: ENSG00000203335
Gene Name: AC006019.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
24-46
0.063
2
CTA-212A2.3
hsa-miR-187-3p
0.960

Gene Details
Chromosome: 22
Transcript: ENST00000624264
Biotype: lincRNA
Gene id: ENSG00000279217
Gene Name: CTA-212A2.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
13814-13835
0.052
Not Conserved
7mer
1111-1131
0.005
Not Conserved
7mer
12420-12445
0.003
1
6mer
6630-6646
0.002
1
RP11-449D8.1
hsa-miR-187-3p
0.958

Gene Details
Chromosome: 18
Transcript: ENST00000583558
Biotype: lincRNA
Gene id: ENSG00000265485
Gene Name: RP11-449D8.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
542-563
0.062
3
AC091801.1
hsa-miR-187-3p
0.958

Gene Details
Chromosome: 7
Transcript: ENST00000402115
Biotype: lincRNA
Gene id: ENSG00000217455
Gene Name: AC091801.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
412-435
0.057
1
6mer
235-262
0.004
2
XLOC_007734
hsa-miR-187-3p
0.957

Gene Details
Chromosome: chr9
Transcript: TCONS_00016354
Biotype: transcript isomorph
Gene id: XLOC_007734
Gene Name: XLOC_007734
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Lung Normal/Primary
- Prostate Normal/Primary


miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
398-418
0.061
1
XLOC_009483
hsa-miR-187-3p
0.954

Gene Details
Chromosome: chr11
Transcript: TCONS_00019682
Biotype: transcript isomorph
Gene id: XLOC_009483
Gene Name: XLOC_009483
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
3575-3599
0.059
1
6mer
917-941
0.001
1
LINC01411
hsa-miR-187-3p
0.949

Gene Details
Chromosome: 5
Transcript: ENST00000504512
Biotype: lincRNA
Gene id: ENSG00000249306
Gene Name: LINC01411
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
250-262
0.058
6
LINC01361
hsa-miR-187-3p
0.948

Gene Details
Chromosome: 1
Transcript: ENST00000452834
Biotype: lincRNA
Gene id: ENSG00000236268
Gene Name: LINC01361
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1475-1489
0.058
2
RP11-483C6.1
hsa-miR-187-3p
0.945

Gene Details
Chromosome: 14
Transcript: ENST00000572358
Biotype: sense_intronic
Gene id: ENSG00000262119
Gene Name: RP11-483C6.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1430-1446
0.057
2
RP11-744K17.1
hsa-miR-187-3p
0.937

Gene Details
Chromosome: 17
Transcript: ENST00000562182
Biotype: lincRNA
Gene id: ENSG00000261020
Gene Name: RP11-744K17.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
4676-4694
0.055
Not Conserved
RP11-844P9.2
hsa-miR-187-3p
0.931

Gene Details
Chromosome: 5
Transcript: ENST00000508056
Biotype: lincRNA
Gene id: ENSG00000248596
Gene Name: RP11-844P9.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
61-81
0.053
Not Conserved
LINC01411
hsa-miR-187-3p
0.929

Gene Details
Chromosome: 5
Transcript: ENST00000511707
Biotype: lincRNA
Gene id: ENSG00000249306
Gene Name: LINC01411
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
118-130
0.053
6
Funded by: