Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-34b-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
chr22-38_28785274-29006793.1
hsa-miR-34b-3p
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
6487-6507
0.013
2
9mer
175565-175585
0.010
2
8mer
78473-78499
0.010
1
7mer
86442-86447
0.007
5
7mer
3623-3641
0.007
4
8mer
263917-263923
0.006
2
7mer
28211-28228
0.005
2
8mer
64080-64093
0.005
1
8mer
200076-200101
0.005
2
9mer
127527-127551
0.005
1
7mer
187543-187557
0.005
4
7mer
176383-176398
0.005
3
7mer
154787-154792
0.005
4
7mer
157459-157471
0.004
2
6mer
267016-267043
0.004
2
7mer
163529-163543
0.004
9
8mer
62648-62659
0.004
2
7mer
170008-170021
0.004
2
7mer
261628-261633
0.004
2
7mer
134454-134476
0.004
Not Conserved
8mer
108032-108057
0.004
2
7mer
150505-150510
0.004
4
8mer
226281-226296
0.004
2
8mer
63409-63415
0.004
1
7mer
978-1002
0.004
2
7mer
169443-169456
0.004
2
6mer
13462-13466
0.004
7
7mer
165105-165123
0.004
Not Conserved
7mer
36772-36785
0.003
2
8mer
186158-186184
0.003
2
7mer
125996-126007
0.003
2
8mer
261250-261263
0.003
Not Conserved
7mer
162242-162247
0.003
2
7mer
82496-82516
0.003
1
6mer
114250-114254
0.003
3
6mer
89252-89256
0.003
2
7mer
188422-188431
0.003
2
7mer
110072-110085
0.003
1
7mer
97142-97154
0.003
1
7mer
55858-55871
0.003
2
6mer
194244-194271
0.002
3
7mer
260758-260763
0.002
2
7mer
17737-17750
0.002
1
6mer
44434-44443
0.002
2
7mer
213921-213941
0.002
2
6mer
123336-123360
0.002
4
6mer
101092-101097
0.002
4
6mer
30838-30843
0.002
2
6mer
87227-87245
0.002
2
6mer
165358-165375
0.002
2
6mer
100075-100085
0.002
5
7mer
12619-12646
0.002
2
6mer
177624-177645
0.002
2
6mer
262790-262809
0.002
2
6mer
169791-169809
0.002
2
7mer
165158-165182
0.002
2
6mer
240126-240141
0.002
2
6mer
197947-197966
0.002
2
6mer
246158-246181
0.002
1
7mer
137975-137987
0.002
1
6mer
149476-149501
0.002
1
6mer
48515-48519
0.002
3
6mer
27214-27218
0.002
3
6mer
254337-254355
0.002
1
6mer
231989-232009
0.002
1
6mer
242672-242697
0.002
1
6mer
95948-95969
0.002
2
6mer
155309-155328
0.002
1
6mer
109219-109241
0.002
2
6mer
150702-150724
0.002
2
6mer
248891-248918
0.002
1
6mer
137809-137828
0.002
2
6mer
84191-84212
0.002
5
6mer
251941-251968
0.002
2
8mer
21220-21240
0.002
2
6mer
112217-112227
0.002
1
6mer
196975-196995
0.002
2
6mer
76776-76803
0.002
2
6mer
57937-57958
0.002
2
6mer
28420-28433
0.002
3
6mer
115684-115693
0.002
2
6mer
27586-27609
0.002
Not Conserved
6mer
29398-29407
0.001
2
6mer
151088-151106
0.001
3
6mer
189171-189195
0.001
1
6mer
177235-177260
0.001
1
6mer
96613-96627
0.001
3
6mer
23739-23759
0.001
2
6mer
103275-103299
0.001
2
6mer
28554-28563
0.001
2
6mer
161398-161418
0.001
Not Conserved
6mer
258843-258869
0.001
2
6mer
213104-213124
0.001
2
6mer
69512-69533
0.001
1
6mer
227230-227243
0.001
1
6mer
130612-130638
0.001
2
6mer
92042-92054
0.001
Not Conserved
6mer
194955-194973
0.001
2
6mer
182275-182297
0.001
2
6mer
48556-48582
0.001
1
6mer
252259-252274
0.001
2
6mer
155700-155725
0.001
2
7mer
226302-226325
0.001
2
6mer
122212-122228
0.001
Not Conserved
6mer
226278-226300
0.000
3
XLOC_010706
hsa-miR-34b-3p
0.997

Gene Details
Chromosome: chr13
Transcript: TCONS_00021520
Biotype: transcript isomorph
Gene id: XLOC_010706
Gene Name: XLOC_010706
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
3903-3915
0.022
2
6mer
174-183
0.019
2
8mer
714-722
0.017
1
6mer
204-215
0.016
2
6mer
431-456
0.007
1
6mer
276-288
0.006
1
6mer
427-453
0.005
1
6mer
360-371
0.005
1
6mer
935-961
0.004
1
6mer
2851-2855
0.004
1
6mer
2761-2778
0.002
1
RP11-347J14.7
hsa-miR-34b-3p
0.997

Gene Details
Chromosome: 9
Transcript: ENST00000423499
Biotype: lincRNA
Gene id: ENSG00000231140
Gene Name: RP11-347J14.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Lung Normal/Primary
- Ovary Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
9-34
0.108
2
XLOC_013265
hsa-miR-34b-3p
0.997

Gene Details
Chromosome: chr19
Transcript: TCONS_00027227
Biotype: transcript isomorph
Gene id: XLOC_013265
Gene Name: XLOC_013265
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
31-53
0.105
1
XLOC_013093
hsa-miR-34b-3p
0.996

Gene Details
Chromosome: chr19
Transcript: TCONS_00027051
Biotype: transcript isomorph
Gene id: XLOC_013093
Gene Name: XLOC_013093
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2190-2196
0.029
3
7mer
2558-2576
0.026
3
8mer
1781-1787
0.017
2
6mer
2660-2675
0.011
2
7mer
2434-2439
0.007
Not Conserved
6mer
722-748
0.005
2
6mer
972-999
0.003
1
6mer
1781-1802
0.002
2
XLOC_009652
hsa-miR-34b-3p
0.994

Gene Details
Chromosome: chr12
Transcript: TCONS_00021053
Biotype: transcript isomorph
Gene id: XLOC_009652
Gene Name: XLOC_009652
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
122-135
0.075
2
6mer
229-233
0.021
2
RP13-216E22.4
hsa-miR-34b-3p
0.994

Gene Details
Chromosome: X
Transcript: ENST00000444482
Biotype: lincRNA
Gene id: ENSG00000228906
Gene Name: RP13-216E22.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
390-412
0.095
2
XLOC_013274
hsa-miR-34b-3p
0.993

Gene Details
Chromosome: chr19
Transcript: TCONS_00027238
Biotype: transcript isomorph
Gene id: XLOC_013274
Gene Name: XLOC_013274
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
5765-5783
0.022
2
7mer
5437-5454
0.015
2
7mer
6433-6446
0.014
1
6mer
5579-5598
0.009
2
6mer
5249-5275
0.007
2
6mer
3386-3411
0.007
2
6mer
2612-2623
0.005
2
7mer
1588-1610
0.005
2
8mer
1561-1587
0.004
1
7mer
1701-1706
0.002
Not Conserved
6mer
3320-3338
0.001
1
CTD-2017D11.1
hsa-miR-34b-3p
0.993

Gene Details
Chromosome: 19
Transcript: ENST00000594934
Biotype: lincRNA
Gene id: ENSG00000268362
Gene Name: CTD-2017D11.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
518-540
0.021
2
6mer
309-317
0.018
2
6mer
1397-1416
0.012
2
7mer
1707-1724
0.010
1
6mer
602-616
0.009
2
6mer
630-644
0.008
2
6mer
1321-1332
0.008
1
7mer
554-573
0.006
1
RP11-708H21.4
hsa-miR-34b-3p
0.980

Gene Details
Chromosome: 17
Transcript: ENST00000575159
Biotype: lincRNA
Gene id: ENSG00000262973
Gene Name: RP11-708H21.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
34-58
0.069
2
6mer
886-905
0.006
1
AC008132.15
hsa-miR-34b-3p
0.980

Gene Details
Chromosome: 22
Transcript: ENST00000611876
Biotype: lincRNA
Gene id: ENSG00000182824
Gene Name: AC008132.15
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
612-631
0.058
1
6mer
882-895
0.016
1
CTD-2017D11.1
hsa-miR-34b-3p
0.980

Gene Details
Chromosome: 19
Transcript: ENST00000597683
Biotype: lincRNA
Gene id: ENSG00000268362
Gene Name: CTD-2017D11.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
383-391
0.017
2
7mer
841-863
0.017
2
6mer
1720-1739
0.016
2
6mer
1644-1655
0.009
1
6mer
925-939
0.007
2
6mer
953-967
0.005
2
7mer
877-896
0.004
1
XLOC_001464
hsa-miR-34b-3p
0.978

Gene Details
Chromosome: chr2
Transcript: TCONS_00003671
Biotype: transcript isomorph
Gene id: XLOC_001464
Gene Name: XLOC_001464
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
A549 Lung Cancer/Malignant
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
163-182
0.066
9
6mer
895-906
0.006
4
AC079807.2
hsa-miR-34b-3p
0.975

Gene Details
Chromosome: 2
Transcript: ENST00000417692
Biotype: antisense
Gene id: ENSG00000233230
Gene Name: AC079807.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
47-66
0.071
9
MALAT1
hsa-miR-34b-3p
0.973

Gene Details
Chromosome: 11
Transcript: ENST00000618132
Biotype: lincRNA
Gene id: ENSG00000251562
Gene Name: MALAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
342-357
0.054
8
7mer
422-439
0.015
8
CTD-2561J22.5
hsa-miR-34b-3p
0.970

Gene Details
Chromosome: 19
Transcript: ENST00000600469
Biotype: lincRNA
Gene id: ENSG00000268119
Gene Name: CTD-2561J22.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
260-278
0.022
2
6mer
789-802
0.019
2
7mer
172-185
0.014
1
7mer
422-435
0.013
1
RP11-324E6.10
hsa-miR-34b-3p
0.970

Gene Details
Chromosome: 12
Transcript: ENST00000613543
Biotype: lincRNA
Gene id: ENSG00000274191
Gene Name: RP11-324E6.10
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
72-89
0.068
2
RP3-323A16.1
hsa-miR-34b-3p
0.970

Gene Details
Chromosome: 22
Transcript: ENST00000623959
Biotype: antisense
Gene id: ENSG00000279184
Gene Name: RP3-323A16.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
33045-33055
0.009
Not Conserved
7mer
37532-37550
0.007
6
7mer
52694-52699
0.005
1
7mer
30940-30953
0.004
1
6mer
13645-13664
0.004
7
7mer
49381-49406
0.003
1
7mer
52841-52859
0.003
1
6mer
53028-53032
0.003
2
6mer
14651-14672
0.003
2
6mer
42218-42234
0.003
3
6mer
29536-29554
0.002
2
6mer
17384-17404
0.002
3
6mer
29094-29119
0.002
Not Conserved
6mer
26432-26451
0.002
1
6mer
15168-15190
0.002
2
6mer
9842-9865
0.002
2
6mer
13716-13727
0.002
7
6mer
22856-22878
0.002
2
6mer
4423-4440
0.001
1
6mer
17555-17581
0.001
2
6mer
39983-39987
0.001
Not Conserved
6mer
29739-29757
0.001
2
6mer
51794-51818
0.001
3
6mer
49844-49860
0.001
1
6mer
6214-6233
0.001
1
AC008103.4
hsa-miR-34b-3p
0.970

Gene Details
Chromosome: 22
Transcript: ENST00000623570
Biotype: sense_intronic
Gene id: ENSG00000279987
Gene Name: AC008103.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
442-462
0.067
2
XLOC_012065
hsa-miR-34b-3p
0.969

Gene Details
Chromosome: chr17
Transcript: TCONS_00025791
Biotype: transcript isomorph
Gene id: XLOC_012065
Gene Name: XLOC_012065
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Ovary Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
238-264
0.012
1
7mer
156-180
0.011
1
7mer
70-96
0.011
1
7mer
196-222
0.010
1
7mer
30-54
0.009
1
6mer
282-306
0.007
1
6mer
114-138
0.007
1
Funded by: