Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-3615

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
AC006116.15
hsa-miR-3615
1.000

Gene Details
Chromosome: 19
Transcript: ENST00000593258
Biotype: sense_intronic
Gene id: ENSG00000267429
Gene Name: AC006116.15
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
57-71
0.199
1
LINC00421
hsa-miR-3615
1.000

Gene Details
Chromosome: 13
Transcript: ENST00000413833
Biotype: lincRNA
Gene id: ENSG00000236834
Gene Name: LINC00421
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
128-152
0.146
1
XLOC_010290
hsa-miR-3615
1.000

Gene Details
Chromosome: chr13
Transcript: TCONS_00021468
Biotype: transcript isomorph
Gene id: XLOC_010290
Gene Name: XLOC_010290
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
128-152
0.145
1
chr22-38_28785274-29006793.1
hsa-miR-3615
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
224601-224622
0.010
2
9mer
46975-46996
0.007
2
7mer
144956-144978
0.004
4
7mer
12377-12388
0.003
1
6mer
59789-59794
0.003
7
7mer
200960-200976
0.002
1
6mer
81284-81298
0.002
5
6mer
130324-130345
0.002
2
6mer
238447-238451
0.002
1
6mer
13188-13206
0.002
7
6mer
186469-186490
0.002
Not Conserved
6mer
148207-148216
0.002
7
6mer
115984-116004
0.002
7
7mer
237227-237241
0.002
Not Conserved
6mer
229517-229535
0.002
2
6mer
153001-153025
0.002
2
7mer
142627-142650
0.002
1
6mer
60074-60087
0.002
1
6mer
124900-124925
0.002
6
6mer
248508-248526
0.002
1
6mer
163401-163415
0.001
5
6mer
32270-32292
0.001
3
6mer
70760-70779
0.001
2
6mer
16147-16172
0.001
1
6mer
212110-212130
0.001
5
6mer
7532-7559
0.001
4
7mer
118612-118635
0.001
1
6mer
230778-230801
0.001
1
6mer
81991-82008
0.001
1
6mer
108750-108771
0.001
1
6mer
16850-16869
0.001
2
6mer
240566-240592
0.001
1
6mer
241218-241237
0.001
1
6mer
162901-162917
0.001
5
6mer
102713-102740
0.001
2
6mer
106078-106102
0.001
3
6mer
148501-148523
0.001
4
6mer
206969-206983
0.001
1
6mer
35710-35723
0.001
3
6mer
168513-168526
0.001
3
6mer
98398-98416
0.001
3
6mer
140131-140151
0.001
4
6mer
49799-49821
0.001
1
6mer
255615-255631
0.001
3
6mer
159724-159744
0.001
2
6mer
140331-140350
0.001
1
8mer+wobble
116581-116599
0.001
6
6mer
161884-161901
0.001
Not Conserved
6mer
124772-124786
0.001
2
6mer
103908-103916
0.001
1
6mer
233556-233581
0.001
1
6mer
144071-144091
0.001
1
6mer
185407-185434
0.001
2
6mer
75504-75527
0.001
2
6mer
85604-85619
0.001
1
6mer
234092-234113
0.001
2
6mer
62955-62982
0.001
1
6mer
28434-28448
0.001
2
6mer
61052-61069
0.001
2
6mer
116257-116284
0.001
2
6mer
75175-75195
0.001
2
6mer
88387-88407
0.001
1
6mer
204168-204195
0.001
2
6mer
88093-88110
0.001
3
6mer
145046-145071
0.001
6
6mer
88477-88497
0.001
2
6mer
165991-166018
0.001
2
6mer
161958-161980
0.001
3
6mer
236102-236118
0.001
1
6mer
217553-217570
0.001
3
6mer
251887-251904
0.001
1
6mer
63230-63256
0.001
1
6mer
180084-180105
0.001
2
8mer+mismatch
4553-4569
0.001
2
6mer
58035-58062
0.001
3
6mer
246884-246909
0.001
1
6mer
2178-2196
0.001
1
6mer
195380-195402
0.001
1
6mer
254401-254428
0.001
3
6mer
239907-239930
0.001
2
6mer
124918-124927
0.001
7
6mer
52760-52782
0.001
3
6mer
162039-162055
0.001
2
6mer
99570-99595
0.001
2
6mer
141117-141142
0.001
1
6mer
188381-188393
0.001
1
6mer
257542-257559
0.001
1
6mer
53060-53077
0.001
2
6mer
249804-249823
0.001
Not Conserved
6mer
32270-32294
0.001
3
6mer
114524-114544
0.001
1
6mer
35710-35727
0.001
2
6mer
102715-102742
0.001
2
6mer
108766-108773
0.001
1
6mer
35710-35725
0.001
3
6mer
212116-212132
0.000
5
6mer
88108-88134
0.000
2
6mer
200968-200978
0.000
1
6mer
254864-254887
0.000
1
6mer
108767-108775
0.000
1
6mer
124772-124788
0.000
2
6mer
248508-248528
0.000
1
6mer
58100-58126
0.000
2
6mer
124776-124794
0.000
4
6mer
108766-108777
0.000
2
6mer
62971-62984
0.000
2
6mer
108767-108779
0.000
2
6mer
217553-217572
0.000
3
8mer+mismatch
260104-260129
0.000
Not Conserved
6mer
124772-124792
0.000
2
6mer
124772-124790
0.000
1
6mer
108766-108781
0.000
1
6mer
257542-257561
0.000
1
6mer
254871-254889
0.000
1
RP11-218M11.3
hsa-miR-3615
0.999

Gene Details
Chromosome: 17
Transcript: ENST00000579378
Biotype: lincRNA
Gene id: ENSG00000263860
Gene Name: RP11-218M11.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
23-47
0.131
1
RP11-713P17.3
hsa-miR-3615
0.998

Gene Details
Chromosome: 11
Transcript: ENST00000532706
Biotype: lincRNA
Gene id: ENSG00000204241
Gene Name: RP11-713P17.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
28-54
0.097
2
8mer
48-72
0.015
2
RP11-713P17.3
hsa-miR-3615
0.997

Gene Details
Chromosome: 11
Transcript: ENST00000533922
Biotype: lincRNA
Gene id: ENSG00000204241
Gene Name: RP11-713P17.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
143-169
0.091
2
8mer
163-187
0.013
2
6mer
1363-1379
0.003
2
XLOC_009341
hsa-miR-3615
0.997

Gene Details
Chromosome: chr11
Transcript: TCONS_00019080
Biotype: transcript isomorph
Gene id: XLOC_009341
Gene Name: XLOC_009341
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Kidney Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
143-169
0.091
2
8mer
163-187
0.013
2
6mer
1561-1577
0.002
2
RP11-671J11.4
hsa-miR-3615
0.996

Gene Details
Chromosome: 14
Transcript: ENST00000554608
Biotype: antisense
Gene id: ENSG00000259135
Gene Name: RP11-671J11.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
60-75
0.006
2
6mer
28-53
0.006
2
6mer
18-44
0.005
1
6mer
6-28
0.005
2
6mer
6-30
0.004
2
6mer
28-51
0.004
2
6mer
108-133
0.004
2
6mer
117-135
0.004
2
6mer
117-137
0.004
2
6mer
117-139
0.004
2
6mer
99-125
0.004
1
6mer
108-127
0.004
1
6mer
60-84
0.004
1
6mer
97-123
0.003
1
6mer
108-129
0.003
1
6mer
108-131
0.003
1
6mer
151-170
0.003
1
6mer
60-82
0.003
1
6mer
144-166
0.003
1
6mer
71-86
0.003
1
6mer
73-99
0.003
2
6mer
71-88
0.003
1
6mer
88-108
0.003
1
6mer
144-168
0.003
1
6mer
97-121
0.003
Not Conserved
6mer
137-164
0.003
1
6mer
71-90
0.003
1
6mer
95-110
0.002
1
6mer
168-192
0.002
1
6mer
168-194
0.001
Not Conserved
RP11-671J11.7
hsa-miR-3615
0.992

Gene Details
Chromosome: 14
Transcript: ENST00000623749
Biotype: lincRNA
Gene id: ENSG00000259002
Gene Name: RP11-671J11.7
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
878-893
0.005
2
6mer
900-925
0.005
2
6mer
909-935
0.004
1
6mer
923-947
0.004
2
6mer
828-854
0.003
1
6mer
902-925
0.003
2
6mer
820-845
0.003
2
6mer
818-836
0.003
2
6mer
826-845
0.003
1
6mer
816-836
0.003
2
6mer
814-836
0.003
2
6mer
869-893
0.003
1
6mer
925-947
0.003
1
6mer
830-856
0.003
1
6mer
832-856
0.003
1
6mer
865-882
0.003
2
6mer
824-845
0.003
1
6mer
783-802
0.003
1
6mer
822-845
0.003
1
6mer
871-893
0.003
1
6mer
787-809
0.003
1
6mer
863-882
0.003
2
6mer
867-882
0.003
1
6mer
785-809
0.002
1
6mer
845-865
0.002
1
6mer
789-816
0.002
1
6mer
843-858
0.002
1
6mer
854-880
0.002
1
6mer
761-785
0.002
1
6mer
759-785
0.001
Not Conserved
XLOC_013024
hsa-miR-3615
0.991

Gene Details
Chromosome: chr19
Transcript: TCONS_00026972
Biotype: transcript isomorph
Gene id: XLOC_013024
Gene Name: XLOC_013024
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
31-41
0.014
1
6mer
696-721
0.013
1
6mer
802-826
0.013
1
6mer
83-109
0.012
1
6mer
646-663
0.012
1
6mer
225-245
0.012
1
6mer
462-489
0.009
1
6mer
402-419
0.002
Not Conserved
FOXD3-AS1
hsa-miR-3615
0.991

Gene Details
Chromosome: 1
Transcript: ENST00000418244
Biotype: antisense
Gene id: ENSG00000230798
Gene Name: FOXD3-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
545-556
0.058
4
7mer
171-196
0.029
2
LINC00461
hsa-miR-3615
0.987

Gene Details
Chromosome: 5
Transcript: ENST00000513805
Biotype: lincRNA
Gene id: ENSG00000245526
Gene Name: LINC00461
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
529-547
0.007
7
6mer
527-547
0.007
8
6mer
525-547
0.006
7
6mer
523-547
0.005
7
6mer
521-540
0.005
7
6mer
505-529
0.005
7
6mer
531-547
0.005
5
6mer
499-523
0.005
5
6mer
517-535
0.005
6
6mer
519-535
0.004
6
6mer
513-535
0.004
6
6mer
503-527
0.004
5
6mer
511-535
0.004
5
6mer
509-533
0.004
5
6mer
515-535
0.004
5
6mer
501-525
0.004
5
6mer
507-531
0.004
5
KCNQ1OT1
hsa-miR-3615
0.982

Gene Details
Chromosome: 11
Transcript: ENST00000597346
Biotype: antisense
Gene id: ENSG00000269821
Gene Name: KCNQ1OT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
179-196
0.004
2
8mer+wobble
65208-65231
0.004
2
6mer
177-196
0.003
2
6mer
613-632
0.002
2
6mer
8096-8113
0.002
2
8mer
43757-43777
0.002
3
6mer
88617-88639
0.002
3
6mer
41508-41526
0.002
2
6mer
48758-48785
0.002
4
6mer
2695-2713
0.002
3
6mer
524-542
0.002
2
6mer
54526-54545
0.002
3
6mer
526-542
0.002
2
6mer
70110-70128
0.002
2
6mer
35703-35717
0.002
1
6mer
54041-54066
0.002
5
6mer
28743-28765
0.002
1
6mer
58459-58473
0.002
2
6mer
25841-25848
0.002
1
6mer
48051-48075
0.002
3
6mer
34230-34246
0.002
1
6mer
4944-4966
0.002
3
6mer
3643-3660
0.001
2
6mer
75678-75699
0.001
4
6mer
87252-87279
0.001
2
6mer
23170-23191
0.001
1
6mer
41402-41421
0.001
2
6mer
75542-75556
0.001
2
6mer
73313-73339
0.001
2
6mer
43318-43331
0.001
2
6mer
83362-83379
0.001
2
6mer
82075-82092
0.001
2
6mer
21211-21231
0.001
Not Conserved
6mer
80019-80043
0.001
2
6mer
48420-48439
0.001
1
6mer
72992-73011
0.001
1
6mer
83721-83741
0.001
2
6mer
60376-60391
0.001
1
6mer
84994-85012
0.001
3
6mer
75990-76009
0.001
2
6mer
73856-73874
0.001
1
6mer
81851-81878
0.001
2
6mer
42682-42701
0.001
1
6mer
65926-65942
0.001
3
6mer
41383-41404
0.001
2
6mer
30878-30902
0.001
Not Conserved
6mer
25835-25847
0.001
1
6mer
78935-78955
0.001
2
6mer
48418-48436
0.001
2
6mer
25837-25847
0.001
1
6mer
25839-25848
0.000
1
6mer
75988-76006
0.000
5
6mer
72990-73007
0.000
1
6mer
73843-73868
0.000
3
6mer
82073-82092
0.000
1
CTD-2553C6.1
hsa-miR-3615
0.975

Gene Details
Chromosome: 19
Transcript: ENST00000592332
Biotype: antisense
Gene id: ENSG00000267650
Gene Name: CTD-2553C6.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
1061-1087
0.004
2
6mer
1063-1089
0.004
2
6mer
952-978
0.004
1
6mer
827-851
0.004
2
6mer
942-968
0.004
2
6mer
1015-1035
0.003
1
6mer
1015-1033
0.003
1
6mer
920-944
0.003
4
6mer
952-976
0.003
1
6mer
1073-1100
0.003
3
6mer
767-789
0.003
3
6mer
827-849
0.003
2
6mer
1029-1051
0.003
2
6mer
775-791
0.003
2
6mer
111-138
0.003
5
6mer
845-861
0.003
1
6mer
892-912
0.003
2
6mer
775-801
0.002
2
6mer
775-793
0.002
2
6mer
785-809
0.002
1
6mer
722-742
0.002
2
6mer
785-811
0.002
1
6mer
709-734
0.002
1
6mer
722-746
0.001
2
6mer
722-744
0.001
2
LINC00461
hsa-miR-3615
0.972

Gene Details
Chromosome: 5
Transcript: ENST00000511014
Biotype: lincRNA
Gene id: ENSG00000245526
Gene Name: LINC00461
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
2364-2391
0.009
1
6mer
3397-3417
0.004
8
6mer
3395-3417
0.004
7
6mer
3399-3417
0.004
7
6mer
3391-3410
0.004
7
6mer
3393-3417
0.004
7
6mer
3369-3393
0.003
5
6mer
3401-3417
0.003
5
6mer
3375-3399
0.003
7
6mer
3387-3405
0.003
6
6mer
3389-3405
0.003
6
6mer
3383-3405
0.003
6
6mer
3373-3397
0.003
5
6mer
3381-3405
0.003
5
6mer
3385-3405
0.003
5
6mer
3379-3403
0.003
5
6mer
3371-3395
0.003
5
6mer
3377-3401
0.003
5
6mer
2876-2903
0.002
2
6mer
2273-2284
0.001
1
FAM201A
hsa-miR-3615
0.968

Gene Details
Chromosome: 9
Transcript: ENST00000484285
Biotype: antisense
Gene id: ENSG00000204860
Gene Name: FAM201A
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1016-1029
0.051
2
6mer
77-100
0.012
2
6mer
913-937
0.003
2
AC012594.1
hsa-miR-3615
0.967

Gene Details
Chromosome: 2
Transcript: ENST00000597915
Biotype: antisense
Gene id: ENSG00000231898
Gene Name: AC012594.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
233-255
0.046
1
6mer
26-39
0.007
4
6mer
24-39
0.006
1
6mer
474-501
0.004
2
6mer
225-244
0.003
2
XLOC_009436
hsa-miR-3615
0.966

Gene Details
Chromosome: chr11
Transcript: TCONS_00019634
Biotype: transcript isomorph
Gene id: XLOC_009436
Gene Name: XLOC_009436
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
176-188
0.051
2
6mer
560-586
0.008
4
6mer
549-572
0.006
2
LINC00461
hsa-miR-3615
0.961

Gene Details
Chromosome: 5
Transcript: ENST00000509265
Biotype: lincRNA
Gene id: ENSG00000245526
Gene Name: LINC00461
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
554-572
0.005
7
6mer
552-572
0.005
8
6mer
550-572
0.004
7
6mer
548-572
0.004
7
6mer
546-565
0.004
7
6mer
524-548
0.004
5
6mer
530-554
0.004
7
6mer
544-560
0.004
6
6mer
542-560
0.004
6
6mer
538-560
0.004
6
6mer
528-552
0.004
5
6mer
540-560
0.003
5
6mer
536-560
0.003
5
6mer
534-558
0.003
5
6mer
532-556
0.003
5
6mer
526-550
0.003
5
Funded by: