Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-582-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
chr22-38_28785274-29006793.1
hsa-miR-582-3p
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
104682-104706
0.023
2
9mer
148333-148341
0.016
1
8mer
247688-247715
0.015
1
8mer
7309-7331
0.012
6
7mer
81427-81448
0.012
10
8mer
47912-47919
0.011
2
8mer
168606-168615
0.011
1
8mer
231375-231385
0.008
1
7mer
166390-166401
0.008
5
8mer
114270-114291
0.007
3
8mer
217076-217089
0.007
3
7mer
188822-188843
0.007
2
8mer
146234-146256
0.005
2
7mer
149063-149075
0.005
3
7mer
208387-208403
0.005
2
7mer
200823-200837
0.005
1
7mer
85086-85091
0.004
2
7mer
52396-52408
0.004
Not Conserved
7mer
123108-123120
0.004
1
7mer
162641-162663
0.004
1
7mer
253216-253238
0.004
2
7mer
178192-178205
0.004
2
7mer
251027-251052
0.004
1
7mer
159646-159655
0.003
1
7mer
23469-23490
0.003
1
7mer
136246-136271
0.003
2
7mer
193455-193478
0.003
1
7mer
192014-192028
0.003
2
7mer
101797-101815
0.003
3
6mer
200211-200229
0.002
2
6mer
217405-217426
0.002
5
6mer
226677-226695
0.002
1
6mer
4696-4715
0.002
2
6mer
71666-71689
0.002
2
6mer
146120-146130
0.002
4
6mer
187478-187497
0.002
3
6mer
28577-28594
0.002
5
6mer
1205-1213
0.002
4
6mer
37974-38000
0.002
2
6mer
63470-63486
0.002
4
6mer
61622-61635
0.002
3
6mer
20600-20621
0.002
5
6mer
198711-198720
0.002
1
6mer
218584-218610
0.002
2
6mer
163604-163629
0.002
6
7mer
257717-257742
0.002
1
6mer
107807-107821
0.002
3
6mer
182296-182308
0.002
2
6mer
70382-70406
0.002
2
6mer
34110-34125
0.002
3
6mer
134051-134060
0.002
3
6mer
169107-169121
0.002
1
6mer
51928-51948
0.002
2
6mer
6008-6029
0.002
2
6mer
196628-196643
0.002
2
6mer
151879-151897
0.001
Not Conserved
6mer
1604-1627
0.001
4
6mer
121762-121782
0.001
2
6mer
41130-41147
0.001
4
6mer
3723-3736
0.001
2
6mer
179902-179922
0.001
2
6mer
99507-99530
0.001
3
6mer
241396-241411
0.001
1
6mer
169808-169821
0.001
2
6mer
19590-19608
0.001
2
6mer
30497-30511
0.001
2
6mer
158426-158446
0.001
Not Conserved
6mer
10252-10273
0.001
2
6mer
217616-217639
0.001
2
6mer
152481-152506
0.001
1
7mer
61729-61749
0.001
2
6mer
205459-205480
0.001
2
6mer
179783-179798
0.001
2
6mer
214875-214896
0.001
Not Conserved
6mer
185641-185662
0.001
1
6mer
237233-237254
0.001
1
6mer
29512-29529
0.001
2
6mer
39592-39614
0.001
2
6mer
200260-200268
0.001
4
6mer
85133-85150
0.001
2
6mer
215435-215456
0.001
2
6mer
76303-76316
0.001
1
7mer
163627-163653
0.001
2
6mer
240277-240301
0.001
2
6mer
198733-198758
0.001
2
6mer
38019-38030
0.001
3
RP4-614O4.12
hsa-miR-582-3p
1.000

Gene Details
Chromosome: 20
Transcript: ENST00000594413
Biotype: lincRNA
Gene id: ENSG00000269202
Gene Name: RP4-614O4.12
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1094-1113
0.041
1
8mer
303-310
0.040
1
7mer
1003-1026
0.039
2
7mer
213-227
0.023
1
XLOC_006091
hsa-miR-582-3p
1.000

Gene Details
Chromosome: chr7
Transcript: TCONS_00013442
Biotype: transcript isomorph
Gene id: XLOC_006091
Gene Name: XLOC_006091
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
359-383
0.136
2
RP11-504P24.9
hsa-miR-582-3p
0.998

Gene Details
Chromosome: 1
Transcript: ENST00000618397
Biotype: lincRNA
Gene id: ENSG00000278467
Gene Name: RP11-504P24.9
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
398-411
0.115
1
CTD-3105H18.13
hsa-miR-582-3p
0.997

Gene Details
Chromosome: 19
Transcript: ENST00000563695
Biotype: lincRNA
Gene id: ENSG00000261280
Gene Name: CTD-3105H18.13
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
349-375
0.084
2
6mer
63-78
0.021
2
AC006548.28
hsa-miR-582-3p
0.996

Gene Details
Chromosome: 22
Transcript: ENST00000623130
Biotype: sense_overlapping
Gene id: ENSG00000280156
Gene Name: AC006548.28
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
34419-34433
0.019
3
7mer
385-401
0.009
2
7mer
7572-7591
0.008
2
8mer
47253-47263
0.007
Not Conserved
7mer
657-683
0.005
Not Conserved
7mer
52378-52394
0.004
Not Conserved
6mer
414-428
0.004
2
7mer
40638-40663
0.004
1
8mer
74142-74153
0.003
1
7mer
75314-75341
0.003
1
7mer
25317-25334
0.002
1
7mer
37225-37244
0.002
2
6mer
68699-68714
0.002
1
6mer
67396-67411
0.002
1
6mer
29029-29051
0.002
2
6mer
37391-37406
0.002
2
6mer
7093-7102
0.002
2
6mer
67195-67206
0.002
1
6mer
74422-74444
0.002
2
6mer
78122-78144
0.002
1
6mer
32636-32658
0.002
2
6mer
61211-61218
0.002
2
6mer
33436-33458
0.002
1
6mer
16790-16813
0.001
2
6mer
79001-79021
0.001
1
6mer
24987-25010
0.001
2
6mer
70204-70226
0.001
1
6mer
21872-21882
0.001
2
6mer
16608-16616
0.001
2
6mer
5091-5112
0.001
1
6mer
74745-74762
0.001
1
6mer
29887-29907
0.001
1
6mer
78100-78125
0.001
1
RP11-203B9.4
hsa-miR-582-3p
0.995

Gene Details
Chromosome: 6
Transcript: ENST00000589263
Biotype: antisense
Gene id: ENSG00000226803
Gene Name: RP11-203B9.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
280-291
0.098
11
KCNQ1OT1
hsa-miR-582-3p
0.994

Gene Details
Chromosome: 11
Transcript: ENST00000597346
Biotype: antisense
Gene id: ENSG00000269821
Gene Name: KCNQ1OT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
75751-75774
0.022
4
8mer
53098-53107
0.009
2
7mer
89878-89892
0.007
2
7mer
85636-85662
0.005
5
8mer
26547-26557
0.005
Not Conserved
7mer
19207-19212
0.005
2
7mer
75104-75114
0.005
2
7mer
34822-34840
0.005
1
7mer
84034-84060
0.003
1
6mer
44004-44018
0.003
6
7mer
2287-2311
0.003
1
7mer
4033-4039
0.002
1
7mer
73178-73184
0.002
2
7mer
68357-68373
0.002
2
7mer
2153-2161
0.002
2
6mer
56372-56396
0.002
2
6mer
54729-54734
0.002
2
6mer
24783-24808
0.001
2
6mer
88275-88299
0.001
2
6mer
80057-80078
0.001
1
6mer
3824-3836
0.001
2
6mer
75898-75917
0.001
1
6mer
75293-75310
0.001
2
6mer
87554-87571
0.001
1
6mer
81787-81798
0.001
1
6mer
59686-59705
0.001
1
RP5-1059L7.1
hsa-miR-582-3p
0.992

Gene Details
Chromosome: 20
Transcript: ENST00000614771
Biotype: antisense
Gene id: ENSG00000278709
Gene Name: RP5-1059L7.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1905-1923
0.090
6
CTD-2541J13.2
hsa-miR-582-3p
0.991

Gene Details
Chromosome: 18
Transcript: ENST00000583493
Biotype: antisense
Gene id: ENSG00000263424
Gene Name: CTD-2541J13.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
2934-2952
0.067
5
7mer
2611-2628
0.015
9
6mer
2305-2315
0.003
6
6mer
1007-1030
0.002
3
LINC00052
hsa-miR-582-3p
0.988

Gene Details
Chromosome: 15
Transcript: NR_026869.1
Biotype: lincRNA
Gene id: NR_026869.1 (gene)
Gene Name: LINC00052
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1753-1773
0.074
1
6mer
852-865
0.005
9
6mer
696-716
0.004
5
XLOC_010715
hsa-miR-582-3p
0.988

Gene Details
Chromosome: chr13
Transcript: TCONS_00022104
Biotype: transcript isomorph
Gene id: XLOC_010715
Gene Name: XLOC_010715
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
10-31
0.072
2
7mer
1057-1083
0.011
2
RP11-439E19.10
hsa-miR-582-3p
0.987

Gene Details
Chromosome: 1
Transcript: ENST00000567832
Biotype: antisense
Gene id: ENSG00000260855
Gene Name: RP11-439E19.10
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
465-486
0.067
2
8mer
1317-1326
0.011
4
6mer
2185-2210
0.002
2
6mer
878-894
0.002
1
LINC00899
hsa-miR-582-3p
0.986

Gene Details
Chromosome: 22
Transcript: ENST00000609737
Biotype: retained_intron
Gene id: ENSG00000231711
Gene Name: LINC00899
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
3-18
0.080
2
LINC00960
hsa-miR-582-3p
0.986

Gene Details
Chromosome: 3
Transcript: ENST00000492922
Biotype: lincRNA
Gene id: ENSG00000242516
Gene Name: LINC00960
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1789-1812
0.080
1
LINC00052
hsa-miR-582-3p
0.984

Gene Details
Chromosome: 15
Transcript: ENST00000560153
Biotype: lincRNA
Gene id: ENSG00000259527
Gene Name: LINC00052
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1753-1773
0.059
1
7mer
1909-1934
0.010
2
6mer
852-865
0.006
9
6mer
696-716
0.004
5
CERS6-AS1
hsa-miR-582-3p
0.984

Gene Details
Chromosome: 2
Transcript: ENST00000594898
Biotype: antisense
Gene id: ENSG00000227617
Gene Name: CERS6-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
432-452
0.078
2
RP11-18F14.4
hsa-miR-582-3p
0.983

Gene Details
Chromosome: 16
Transcript: ENST00000563684
Biotype: sense_intronic
Gene id: ENSG00000260064
Gene Name: RP11-18F14.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
76-85
0.078
3
AC017074.2
hsa-miR-582-3p
0.983

Gene Details
Chromosome: 2
Transcript: ENST00000424612
Biotype: lincRNA
Gene id: ENSG00000227359
Gene Name: AC017074.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
202-220
0.068
3
6mer
129-136
0.005
1
6mer
229-251
0.004
1
RP11-580I16.2
hsa-miR-582-3p
0.982

Gene Details
Chromosome: 17
Transcript: ENST00000584391
Biotype: antisense
Gene id: ENSG00000263766
Gene Name: RP11-580I16.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
214-239
0.076
9
Funded by: