Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-let-7b-3p

ENST00000568248
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
AC083843.1
hsa-let-7b-3p
0.435

Gene Details
Chromosome: 8
Transcript: ENST00000568248
Biotype: lincRNA
Gene id: ENSG00000259820
Gene Name: AC083843.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
5739-5743
0.006
3
Funded by: