Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-let-7b-3p

ENST00000581915
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP11-227G15.3
hsa-let-7b-3p
0.550

Gene Details
Chromosome: 17
Transcript: ENST00000581915
Biotype: processed_transcript
Gene id: ENSG00000265794
Gene Name: RP11-227G15.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
225-239
0.014
5
Funded by: