Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-let-7b-3p

ENST00000593427
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
CTC-444N24.11
hsa-let-7b-3p
0.887

Gene Details
Chromosome: 19
Transcript: ENST00000593427
Biotype: lincRNA
Gene id: ENSG00000268205
Gene Name: CTC-444N24.11
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
3742-3764
0.014
2
6mer
4030-4041
0.007
2
6mer
3572-3586
0.006
2
6mer
441-445
0.005
1
6mer
3700-3716
0.004
2
6mer
2997-3009
0.004
2
7mer
3061-3077
0.003
2
6mer
2057-2061
0.002
1
Funded by: