Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-let-7b-3p

NR_037618.1
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
EEF1E1-BLOC1S5
hsa-let-7b-3p
0.600

Gene Details
Chromosome: 6
Transcript: NR_037618.1
Biotype: sense
Gene id: NR_037618.1 (gene)
Gene Name: EEF1E1-BLOC1S5
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
58-75
0.012
2
6mer
1768-1783
0.003
6
6mer
1688-1706
0.001
2
6mer
1645-1663
0.001
1
Funded by: