Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-let-7e-5p

ENST00000422117
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
AC124997.1
hsa-let-7e-5p
0.379

Gene Details
Chromosome: 15
Transcript: ENST00000422117
Biotype: lincRNA
Gene id: ENSG00000235731
Gene Name: AC124997.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Brain Normal/Primary
- Heart Normal/Primary
- Liver Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
2099-2109
0.003
2
Funded by: