Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-let-7e-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP11-1102P16.1
hsa-let-7e-5p
0.879

Gene Details
Chromosome: 8
Transcript: ENST00000519927
Biotype: lincRNA
Gene id: ENSG00000253379
Gene Name: RP11-1102P16.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
90-108
0.043
3
DSCR8
hsa-let-7e-5p
0.876

Gene Details
Chromosome: 21
Transcript: NR_026838.1
Biotype: sense
Gene id: NR_026838.1 (gene)
Gene Name: DSCR8
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
787-812
0.043
6
RP11-23J9.4
hsa-let-7e-5p
0.875

Gene Details
Chromosome: 9
Transcript: ENST00000532526
Biotype: processed_transcript
Gene id: ENSG00000255036
Gene Name: RP11-23J9.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
687-713
0.032
7
9mer
1586-1598
0.009
4
7mer
4097-4122
0.002
1
RP11-110G21.1
hsa-let-7e-5p
0.873

Gene Details
Chromosome: 8
Transcript: ENST00000518942
Biotype: antisense
Gene id: ENSG00000228801
Gene Name: RP11-110G21.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
700-716
0.031
2
7mer
598-618
0.008
2
6mer
137-163
0.003
1
XLOC_008608
hsa-let-7e-5p
0.873

Gene Details
Chromosome: chr10
Transcript: TCONS_00017868
Biotype: transcript isomorph
Gene id: XLOC_008608
Gene Name: XLOC_008608
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
580-598
0.023
2
7mer
797-817
0.012
1
6mer
659-678
0.004
2
6mer
348-369
0.003
1
SVIL-AS1
hsa-let-7e-5p
0.873

Gene Details
Chromosome: 10
Transcript: ENST00000423223
Biotype: antisense
Gene id: ENSG00000224597
Gene Name: SVIL-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
348-364
0.042
1
MEG3
hsa-let-7e-5p
0.872

Gene Details
Chromosome: 14
Transcript: NR_046470.2
Biotype: lincRNA
Gene id: NR_046470.2 (gene)
Gene Name: MEG3
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1633-1655
0.040
6
6mer
192-216
0.002
1
LINC00174
hsa-let-7e-5p
0.871

Gene Details
Chromosome: 7
Transcript: NR_026873.1
Biotype: antisense
Gene id: NR_026873.1 (gene)
Gene Name: LINC00174
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer+wobble
268-289
0.022
2
8mer+wobble
4364-4380
0.009
1
6mer
3950-3975
0.003
2
6mer
155-182
0.003
1
8mer+wobble
3013-3036
0.002
1
7mer
3220-3236
0.002
1
RP11-572C21.1
hsa-let-7e-5p
0.871

Gene Details
Chromosome: 12
Transcript: ENST00000502221
Biotype: lincRNA
Gene id: ENSG00000251536
Gene Name: RP11-572C21.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1760-1779
0.042
2
RP11-752L20.5
hsa-let-7e-5p
0.870

Gene Details
Chromosome: 4
Transcript: ENST00000509370
Biotype: lincRNA
Gene id: ENSG00000251688
Gene Name: RP11-752L20.5
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
324-341
0.019
1
9mer
941-967
0.011
2
9mer
539-554
0.011
2
6mer
410-436
0.002
1
RP1-18D14.7
hsa-let-7e-5p
0.869

Gene Details
Chromosome: 1
Transcript: ENST00000422216
Biotype: antisense
Gene id: ENSG00000226252
Gene Name: RP1-18D14.7
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
3894-3904
0.032
1
9mer
1157-1176
0.006
2
6mer
2727-2743
0.003
8
XLOC_008619
hsa-let-7e-5p
0.868

Gene Details
Chromosome: chr10
Transcript: TCONS_00018338
Biotype: transcript isomorph
Gene id: XLOC_008619
Gene Name: XLOC_008619
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Kidney Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
906-929
0.023
3
8mer+wobble
124-145
0.009
1
6mer
1742-1756
0.006
5
6mer
1409-1432
0.004
3
RP11-693J15.5
hsa-let-7e-5p
0.868

Gene Details
Chromosome: 12
Transcript: ENST00000504409
Biotype: lincRNA
Gene id: ENSG00000205056
Gene Name: RP11-693J15.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
9880-9895
0.016
1
7mer
2758-2775
0.006
2
7mer
7718-7733
0.005
2
7mer
8065-8092
0.004
Not Conserved
7mer
7332-7345
0.003
2
6mer
711-716
0.003
2
6mer
5789-5805
0.002
2
6mer
6534-6557
0.001
2
6mer
7759-7770
0.001
1
RP11-23J9.4
hsa-let-7e-5p
0.867

Gene Details
Chromosome: 9
Transcript: ENST00000534123
Biotype: processed_transcript
Gene id: ENSG00000255036
Gene Name: RP11-23J9.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
687-713
0.031
7
9mer
2026-2038
0.009
4
7mer
5152-5177
0.001
1
RP11-384K6.6
hsa-let-7e-5p
0.867

Gene Details
Chromosome: 4
Transcript: ENST00000567913
Biotype: lincRNA
Gene id: ENSG00000260404
Gene Name: RP11-384K6.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1187-1210
0.016
2
8mer
3940-3952
0.007
Not Conserved
8mer+wobble
4350-4364
0.005
1
6mer
551-569
0.003
1
6mer
3547-3565
0.003
Not Conserved
8mer+wobble
2376-2400
0.002
1
6mer
275-295
0.002
Not Conserved
8mer+wobble
3135-3158
0.002
Not Conserved
6mer
1326-1348
0.001
1
RP11-23J9.4
hsa-let-7e-5p
0.866

Gene Details
Chromosome: 9
Transcript: ENST00000357054
Biotype: processed_transcript
Gene id: ENSG00000255036
Gene Name: RP11-23J9.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
687-713
0.031
7
9mer
2026-2038
0.009
4
7mer
4537-4562
0.001
1
XLOC_001882
hsa-let-7e-5p
0.866

Gene Details
Chromosome: chr2
Transcript: TCONS_00004043
Biotype: transcript isomorph
Gene id: XLOC_001882
Gene Name: XLOC_001882
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
291-303
0.020
2
8mer
399-415
0.016
2
7mer
412-422
0.006
1
CTD-2311B13.2
hsa-let-7e-5p
0.865

Gene Details
Chromosome: 14
Transcript: ENST00000549951
Biotype: lincRNA
Gene id: ENSG00000258265
Gene Name: CTD-2311B13.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
99-122
0.041
2
CYP4F26P
hsa-let-7e-5p
0.864

Gene Details
Chromosome: 9
Transcript: ENST00000433357
Biotype: lincRNA
Gene id: ENSG00000226562
Gene Name: CYP4F26P
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
388-414
0.041
1
RP11-809F4.3
hsa-let-7e-5p
0.863

Gene Details
Chromosome: 3
Transcript: ENST00000562617
Biotype: lincRNA
Gene id: ENSG00000260217
Gene Name: RP11-809F4.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
7-31
0.041
1
Funded by: