Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-let-7e-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
ERVH48-1
hsa-let-7e-5p
0.996

Gene Details
Chromosome: 21
Transcript: ENST00000447535
Biotype: lincRNA
Gene id: ENSG00000233056
Gene Name: ERVH48-1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1336-1355
0.086
1
6mer
2171-2193
0.010
1
6mer
1271-1285
0.003
1
MEG3
hsa-let-7e-5p
0.995

Gene Details
Chromosome: 14
Transcript: ENST00000521256
Biotype: lincRNA
Gene id: ENSG00000214548
Gene Name: MEG3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
388-410
0.099
6
XIST
hsa-let-7e-5p
0.995

Gene Details
Chromosome: X
Transcript: ENST00000429829
Biotype: lincRNA
Gene id: ENSG00000229807
Gene Name: XIST
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
224-248
0.077
2
8mer
5973-5994
0.009
1
7mer
7034-7048
0.004
1
7mer
12917-12930
0.003
2
6mer
10521-10541
0.002
2
8mer
7015-7037
0.002
2
6mer
17296-17320
0.001
Not Conserved
AC012499.1
hsa-let-7e-5p
0.995

Gene Details
Chromosome: 2
Transcript: ENST00000450227
Biotype: antisense
Gene id: ENSG00000229941
Gene Name: AC012499.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
388-400
0.097
2
CTD-2195M15.3
hsa-let-7e-5p
0.994

Gene Details
Chromosome: 5
Transcript: ENST00000607594
Biotype: lincRNA
Gene id: ENSG00000271766
Gene Name: CTD-2195M15.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
34-59
0.093
2
RP11-401P9.1
hsa-let-7e-5p
0.993

Gene Details
Chromosome: 16
Transcript: ENST00000569940
Biotype: antisense
Gene id: ENSG00000260029
Gene Name: RP11-401P9.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
910-925
0.089
6
6mer
652-666
0.002
Not Conserved
KCNQ1OT1
hsa-let-7e-5p
0.993

Gene Details
Chromosome: 11
Transcript: ENST00000597346
Biotype: antisense
Gene id: ENSG00000269821
Gene Name: KCNQ1OT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
80180-80199
0.009
2
7mer
18866-18884
0.009
1
7mer
13620-13639
0.008
2
7mer
75214-75229
0.007
2
7mer
48578-48597
0.006
2
7mer
66826-66840
0.006
2
7mer
68203-68216
0.005
2
7mer
43124-43142
0.003
2
8mer
79015-79031
0.003
2
7mer
37325-37342
0.003
1
8mer+wobble
46098-46114
0.003
2
6mer
42276-42280
0.002
4
7mer
62888-62905
0.002
1
6mer
69904-69922
0.002
2
6mer
56614-56628
0.002
7
6mer
20013-20034
0.002
2
6mer
87820-87844
0.002
4
6mer
69660-69664
0.002
3
6mer
33355-33370
0.002
1
6mer
24787-24801
0.002
2
6mer
18391-18416
0.001
2
6mer
61697-61717
0.001
2
6mer
39301-39327
0.001
1
6mer
38378-38405
0.001
1
6mer
11610-11632
0.001
2
6mer
9410-9427
0.001
2
6mer
76487-76512
0.001
2
6mer
11514-11536
0.001
1
6mer
65369-65392
0.001
1
6mer
31276-31290
0.001
1
6mer
53438-53462
0.001
1
6mer
23438-23458
0.001
2
6mer
62820-62845
0.001
2
RP11-80F22.14
hsa-let-7e-5p
0.992

Gene Details
Chromosome: 16
Transcript: ENST00000566562
Biotype: lincRNA
Gene id: ENSG00000261350
Gene Name: RP11-80F22.14
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
29-51
0.089
1
XLOC_008829
hsa-let-7e-5p
0.991

Gene Details
Chromosome: chr10
Transcript: TCONS_00018522
Biotype: transcript isomorph
Gene id: XLOC_008829
Gene Name: XLOC_008829
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Thyroid Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
195-211
0.088
1
RP11-348P10.2
hsa-let-7e-5p
0.989

Gene Details
Chromosome: 3
Transcript: ENST00000606008
Biotype: lincRNA
Gene id: ENSG00000272077
Gene Name: RP11-348P10.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1466-1489
0.085
3
SLC7A11-AS1
hsa-let-7e-5p
0.989

Gene Details
Chromosome: 4
Transcript: ENST00000510767
Biotype: antisense
Gene id: ENSG00000250033
Gene Name: SLC7A11-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
4585-4611
0.045
2
7mer
322-346
0.025
2
8mer+wobble
3865-3889
0.004
1
6mer
4114-4135
0.003
2
6mer
3473-3495
0.003
2
6mer
401-419
0.002
2
6mer
2277-2293
0.002
2
RP11-347H15.4
hsa-let-7e-5p
0.987

Gene Details
Chromosome: 11
Transcript: ENST00000529219
Biotype: lincRNA
Gene id: ENSG00000254518
Gene Name: RP11-347H15.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
192-218
0.082
2
RP11-552D8.1
hsa-let-7e-5p
0.986

Gene Details
Chromosome: 1
Transcript: ENST00000430623
Biotype: antisense
Gene id: ENSG00000229258
Gene Name: RP11-552D8.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
399-420
0.065
1
8mer
312-338
0.013
2
6mer
358-381
0.002
Not Conserved
AC005027.3
hsa-let-7e-5p
0.986

Gene Details
Chromosome: 7
Transcript: ENST00000416150
Biotype: sense_overlapping
Gene id: ENSG00000236310
Gene Name: AC005027.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
171-192
0.081
2
XLOC_000162
hsa-let-7e-5p
0.986

Gene Details
Chromosome: chr1
Transcript: TCONS_00000039
Biotype: transcript isomorph
Gene id: XLOC_000162
Gene Name: XLOC_000162
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Breast Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Prostate Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
186-205
0.039
1
9mer
1501-1517
0.034
2
8mer+wobble
1010-1031
0.007
1
XIST
hsa-let-7e-5p
0.986

Gene Details
Chromosome: X
Transcript: ENST00000417942
Biotype: lincRNA
Gene id: ENSG00000229807
Gene Name: XIST
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
224-248
0.080
2
CASC7
hsa-let-7e-5p
0.986

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2160-2181
0.039
10
7mer
952-966
0.021
12
7mer
6487-6505
0.010
11
6mer
529-541
0.005
9
6mer
9161-9185
0.005
1
CTD-3018O17.3
hsa-let-7e-5p
0.985

Gene Details
Chromosome: 19
Transcript: ENST00000596746
Biotype: lincRNA
Gene id: ENSG00000269834
Gene Name: CTD-3018O17.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
306-324
0.048
2
7mer
239-257
0.032
2
XIST
hsa-let-7e-5p
0.985

Gene Details
Chromosome: X
Transcript: ENST00000416330
Biotype: lincRNA
Gene id: ENSG00000229807
Gene Name: XIST
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
224-248
0.079
2
XIST
hsa-let-7e-5p
0.985

Gene Details
Chromosome: X
Transcript: ENST00000434839
Biotype: lincRNA
Gene id: ENSG00000229807
Gene Name: XIST
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
229-253
0.079
2
Funded by: